ID: 1182007809

View in Genome Browser
Species Human (GRCh38)
Location 22:26975670-26975692
Sequence GCCTCCAACCCAGGAACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182007802_1182007809 -9 Left 1182007802 22:26975656-26975678 CCCTTCCTCTCTCCGCCTCCAAC No data
Right 1182007809 22:26975670-26975692 GCCTCCAACCCAGGAACCTGGGG No data
1182007803_1182007809 -10 Left 1182007803 22:26975657-26975679 CCTTCCTCTCTCCGCCTCCAACC No data
Right 1182007809 22:26975670-26975692 GCCTCCAACCCAGGAACCTGGGG No data
1182007801_1182007809 -8 Left 1182007801 22:26975655-26975677 CCCCTTCCTCTCTCCGCCTCCAA No data
Right 1182007809 22:26975670-26975692 GCCTCCAACCCAGGAACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182007809 Original CRISPR GCCTCCAACCCAGGAACCTG GGG Intergenic
No off target data available for this crispr