ID: 1182014193

View in Genome Browser
Species Human (GRCh38)
Location 22:27025471-27025493
Sequence CTCCCCTGGCCGGTCACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182014193_1182014200 6 Left 1182014193 22:27025471-27025493 CCCTGGGTGACCGGCCAGGGGAG No data
Right 1182014200 22:27025500-27025522 AAGTGCAGAAATTGGTCTCTTGG No data
1182014193_1182014199 -2 Left 1182014193 22:27025471-27025493 CCCTGGGTGACCGGCCAGGGGAG No data
Right 1182014199 22:27025492-27025514 AGCAGGGCAAGTGCAGAAATTGG No data
1182014193_1182014201 23 Left 1182014193 22:27025471-27025493 CCCTGGGTGACCGGCCAGGGGAG No data
Right 1182014201 22:27025517-27025539 TCTTGGTATTTTATGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182014193 Original CRISPR CTCCCCTGGCCGGTCACCCA GGG (reversed) Intergenic
No off target data available for this crispr