ID: 1182019839

View in Genome Browser
Species Human (GRCh38)
Location 22:27072247-27072269
Sequence GGCACCAAGTATGCTTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182019839_1182019842 7 Left 1182019839 22:27072247-27072269 CCTCTTTAAGCATACTTGGTGCC No data
Right 1182019842 22:27072277-27072299 GCTGCTTCTCATTTGTACAATGG No data
1182019839_1182019844 27 Left 1182019839 22:27072247-27072269 CCTCTTTAAGCATACTTGGTGCC No data
Right 1182019844 22:27072297-27072319 TGGGAACCAACTGTTCTCAATGG No data
1182019839_1182019845 28 Left 1182019839 22:27072247-27072269 CCTCTTTAAGCATACTTGGTGCC No data
Right 1182019845 22:27072298-27072320 GGGAACCAACTGTTCTCAATGGG No data
1182019839_1182019843 8 Left 1182019839 22:27072247-27072269 CCTCTTTAAGCATACTTGGTGCC No data
Right 1182019843 22:27072278-27072300 CTGCTTCTCATTTGTACAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182019839 Original CRISPR GGCACCAAGTATGCTTAAAG AGG (reversed) Intergenic
No off target data available for this crispr