ID: 1182019841

View in Genome Browser
Species Human (GRCh38)
Location 22:27072268-27072290
Sequence AAATGAGAAGCAGCCATGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182019841_1182019844 6 Left 1182019841 22:27072268-27072290 CCTAGCATGGCTGCTTCTCATTT No data
Right 1182019844 22:27072297-27072319 TGGGAACCAACTGTTCTCAATGG No data
1182019841_1182019845 7 Left 1182019841 22:27072268-27072290 CCTAGCATGGCTGCTTCTCATTT No data
Right 1182019845 22:27072298-27072320 GGGAACCAACTGTTCTCAATGGG No data
1182019841_1182019847 17 Left 1182019841 22:27072268-27072290 CCTAGCATGGCTGCTTCTCATTT No data
Right 1182019847 22:27072308-27072330 TGTTCTCAATGGGTGATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182019841 Original CRISPR AAATGAGAAGCAGCCATGCT AGG (reversed) Intergenic
No off target data available for this crispr