ID: 1182019843

View in Genome Browser
Species Human (GRCh38)
Location 22:27072278-27072300
Sequence CTGCTTCTCATTTGTACAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182019836_1182019843 17 Left 1182019836 22:27072238-27072260 CCTAGTTTCCCTCTTTAAGCATA No data
Right 1182019843 22:27072278-27072300 CTGCTTCTCATTTGTACAATGGG No data
1182019839_1182019843 8 Left 1182019839 22:27072247-27072269 CCTCTTTAAGCATACTTGGTGCC No data
Right 1182019843 22:27072278-27072300 CTGCTTCTCATTTGTACAATGGG No data
1182019838_1182019843 9 Left 1182019838 22:27072246-27072268 CCCTCTTTAAGCATACTTGGTGC No data
Right 1182019843 22:27072278-27072300 CTGCTTCTCATTTGTACAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182019843 Original CRISPR CTGCTTCTCATTTGTACAAT GGG Intergenic
No off target data available for this crispr