ID: 1182019844

View in Genome Browser
Species Human (GRCh38)
Location 22:27072297-27072319
Sequence TGGGAACCAACTGTTCTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182019841_1182019844 6 Left 1182019841 22:27072268-27072290 CCTAGCATGGCTGCTTCTCATTT No data
Right 1182019844 22:27072297-27072319 TGGGAACCAACTGTTCTCAATGG No data
1182019838_1182019844 28 Left 1182019838 22:27072246-27072268 CCCTCTTTAAGCATACTTGGTGC No data
Right 1182019844 22:27072297-27072319 TGGGAACCAACTGTTCTCAATGG No data
1182019839_1182019844 27 Left 1182019839 22:27072247-27072269 CCTCTTTAAGCATACTTGGTGCC No data
Right 1182019844 22:27072297-27072319 TGGGAACCAACTGTTCTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182019844 Original CRISPR TGGGAACCAACTGTTCTCAA TGG Intergenic
No off target data available for this crispr