ID: 1182019847

View in Genome Browser
Species Human (GRCh38)
Location 22:27072308-27072330
Sequence TGTTCTCAATGGGTGATAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182019841_1182019847 17 Left 1182019841 22:27072268-27072290 CCTAGCATGGCTGCTTCTCATTT No data
Right 1182019847 22:27072308-27072330 TGTTCTCAATGGGTGATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182019847 Original CRISPR TGTTCTCAATGGGTGATAAG AGG Intergenic
No off target data available for this crispr