ID: 1182020140

View in Genome Browser
Species Human (GRCh38)
Location 22:27074871-27074893
Sequence CTGGAGTCATAGGGAGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182020133_1182020140 -3 Left 1182020133 22:27074851-27074873 CCCTGGTTCTAAATCCCTGTCTG No data
Right 1182020140 22:27074871-27074893 CTGGAGTCATAGGGAGAAACTGG No data
1182020134_1182020140 -4 Left 1182020134 22:27074852-27074874 CCTGGTTCTAAATCCCTGTCTGG No data
Right 1182020140 22:27074871-27074893 CTGGAGTCATAGGGAGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182020140 Original CRISPR CTGGAGTCATAGGGAGAAAC TGG Intergenic
No off target data available for this crispr