ID: 1182021461

View in Genome Browser
Species Human (GRCh38)
Location 22:27085212-27085234
Sequence GTAGATGCCAAGGTTAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182021455_1182021461 -10 Left 1182021455 22:27085199-27085221 CCTTAGACCTTATGTAGATGCCA No data
Right 1182021461 22:27085212-27085234 GTAGATGCCAAGGTTAGGGTGGG No data
1182021454_1182021461 12 Left 1182021454 22:27085177-27085199 CCAATGTCTTATTCTAGAGCTAC No data
Right 1182021461 22:27085212-27085234 GTAGATGCCAAGGTTAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182021461 Original CRISPR GTAGATGCCAAGGTTAGGGT GGG Intergenic
No off target data available for this crispr