ID: 1182022437

View in Genome Browser
Species Human (GRCh38)
Location 22:27091968-27091990
Sequence CTGCAGAAACAGAAAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182022435_1182022437 -4 Left 1182022435 22:27091949-27091971 CCAGAGCAGGAAGAAGGTCCTGC No data
Right 1182022437 22:27091968-27091990 CTGCAGAAACAGAAAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182022437 Original CRISPR CTGCAGAAACAGAAAGAGAC AGG Intergenic
No off target data available for this crispr