ID: 1182024450 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:27107043-27107065 |
Sequence | TTCCCAAGGCTTCCCTTGAC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1182024444_1182024450 | 20 | Left | 1182024444 | 22:27107000-27107022 | CCATGCTTCTTCTGGGCGCAGAG | 0: 1 1: 0 2: 2 3: 12 4: 184 |
||
Right | 1182024450 | 22:27107043-27107065 | TTCCCAAGGCTTCCCTTGACAGG | No data | ||||
1182024441_1182024450 | 27 | Left | 1182024441 | 22:27106993-27107015 | CCAGAACCCATGCTTCTTCTGGG | 0: 1 1: 0 2: 0 3: 17 4: 188 |
||
Right | 1182024450 | 22:27107043-27107065 | TTCCCAAGGCTTCCCTTGACAGG | No data | ||||
1182024443_1182024450 | 21 | Left | 1182024443 | 22:27106999-27107021 | CCCATGCTTCTTCTGGGCGCAGA | 0: 1 1: 0 2: 0 3: 4 4: 111 |
||
Right | 1182024450 | 22:27107043-27107065 | TTCCCAAGGCTTCCCTTGACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1182024450 | Original CRISPR | TTCCCAAGGCTTCCCTTGAC AGG | Intergenic | ||
No off target data available for this crispr |