ID: 1182024450

View in Genome Browser
Species Human (GRCh38)
Location 22:27107043-27107065
Sequence TTCCCAAGGCTTCCCTTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182024444_1182024450 20 Left 1182024444 22:27107000-27107022 CCATGCTTCTTCTGGGCGCAGAG 0: 1
1: 0
2: 2
3: 12
4: 184
Right 1182024450 22:27107043-27107065 TTCCCAAGGCTTCCCTTGACAGG No data
1182024441_1182024450 27 Left 1182024441 22:27106993-27107015 CCAGAACCCATGCTTCTTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 188
Right 1182024450 22:27107043-27107065 TTCCCAAGGCTTCCCTTGACAGG No data
1182024443_1182024450 21 Left 1182024443 22:27106999-27107021 CCCATGCTTCTTCTGGGCGCAGA 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1182024450 22:27107043-27107065 TTCCCAAGGCTTCCCTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182024450 Original CRISPR TTCCCAAGGCTTCCCTTGAC AGG Intergenic
No off target data available for this crispr