ID: 1182029855

View in Genome Browser
Species Human (GRCh38)
Location 22:27149912-27149934
Sequence GATTCTACATCCAAGGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182029851_1182029855 -9 Left 1182029851 22:27149898-27149920 CCTATTGTATGCCAGATTCTACA No data
Right 1182029855 22:27149912-27149934 GATTCTACATCCAAGGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182029855 Original CRISPR GATTCTACATCCAAGGGCTC TGG Intergenic
No off target data available for this crispr