ID: 1182031404

View in Genome Browser
Species Human (GRCh38)
Location 22:27162157-27162179
Sequence GGAACTGTCCTCCATAATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182031404_1182031411 24 Left 1182031404 22:27162157-27162179 CCCTGATTATGGAGGACAGTTCC No data
Right 1182031411 22:27162204-27162226 TGCCCACTTCATGCACAAGCTGG No data
1182031404_1182031409 1 Left 1182031404 22:27162157-27162179 CCCTGATTATGGAGGACAGTTCC No data
Right 1182031409 22:27162181-27162203 GACAGCTTCGACTTGGGCCATGG No data
1182031404_1182031407 -5 Left 1182031404 22:27162157-27162179 CCCTGATTATGGAGGACAGTTCC No data
Right 1182031407 22:27162175-27162197 GTTCCAGACAGCTTCGACTTGGG No data
1182031404_1182031415 28 Left 1182031404 22:27162157-27162179 CCCTGATTATGGAGGACAGTTCC No data
Right 1182031415 22:27162208-27162230 CACTTCATGCACAAGCTGGGAGG No data
1182031404_1182031406 -6 Left 1182031404 22:27162157-27162179 CCCTGATTATGGAGGACAGTTCC No data
Right 1182031406 22:27162174-27162196 AGTTCCAGACAGCTTCGACTTGG No data
1182031404_1182031412 25 Left 1182031404 22:27162157-27162179 CCCTGATTATGGAGGACAGTTCC No data
Right 1182031412 22:27162205-27162227 GCCCACTTCATGCACAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182031404 Original CRISPR GGAACTGTCCTCCATAATCA GGG (reversed) Intergenic
No off target data available for this crispr