ID: 1182031408

View in Genome Browser
Species Human (GRCh38)
Location 22:27162178-27162200
Sequence TGGCCCAAGTCGAAGCTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182031408_1182031416 26 Left 1182031408 22:27162178-27162200 CCAGACAGCTTCGACTTGGGCCA No data
Right 1182031416 22:27162227-27162249 GAGGCTTTTTGCTTTTTGCCTGG No data
1182031408_1182031415 7 Left 1182031408 22:27162178-27162200 CCAGACAGCTTCGACTTGGGCCA No data
Right 1182031415 22:27162208-27162230 CACTTCATGCACAAGCTGGGAGG No data
1182031408_1182031417 27 Left 1182031408 22:27162178-27162200 CCAGACAGCTTCGACTTGGGCCA No data
Right 1182031417 22:27162228-27162250 AGGCTTTTTGCTTTTTGCCTGGG No data
1182031408_1182031411 3 Left 1182031408 22:27162178-27162200 CCAGACAGCTTCGACTTGGGCCA No data
Right 1182031411 22:27162204-27162226 TGCCCACTTCATGCACAAGCTGG No data
1182031408_1182031412 4 Left 1182031408 22:27162178-27162200 CCAGACAGCTTCGACTTGGGCCA No data
Right 1182031412 22:27162205-27162227 GCCCACTTCATGCACAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182031408 Original CRISPR TGGCCCAAGTCGAAGCTGTC TGG (reversed) Intergenic
No off target data available for this crispr