ID: 1182031412

View in Genome Browser
Species Human (GRCh38)
Location 22:27162205-27162227
Sequence GCCCACTTCATGCACAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182031408_1182031412 4 Left 1182031408 22:27162178-27162200 CCAGACAGCTTCGACTTGGGCCA No data
Right 1182031412 22:27162205-27162227 GCCCACTTCATGCACAAGCTGGG No data
1182031404_1182031412 25 Left 1182031404 22:27162157-27162179 CCCTGATTATGGAGGACAGTTCC No data
Right 1182031412 22:27162205-27162227 GCCCACTTCATGCACAAGCTGGG No data
1182031405_1182031412 24 Left 1182031405 22:27162158-27162180 CCTGATTATGGAGGACAGTTCCA No data
Right 1182031412 22:27162205-27162227 GCCCACTTCATGCACAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182031412 Original CRISPR GCCCACTTCATGCACAAGCT GGG Intergenic
No off target data available for this crispr