ID: 1182031416

View in Genome Browser
Species Human (GRCh38)
Location 22:27162227-27162249
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182031413_1182031416 -2 Left 1182031413 22:27162206-27162228 CCCACTTCATGCACAAGCTGGGA No data
Right 1182031416 22:27162227-27162249 GAGGCTTTTTGCTTTTTGCCTGG No data
1182031408_1182031416 26 Left 1182031408 22:27162178-27162200 CCAGACAGCTTCGACTTGGGCCA No data
Right 1182031416 22:27162227-27162249 GAGGCTTTTTGCTTTTTGCCTGG No data
1182031414_1182031416 -3 Left 1182031414 22:27162207-27162229 CCACTTCATGCACAAGCTGGGAG No data
Right 1182031416 22:27162227-27162249 GAGGCTTTTTGCTTTTTGCCTGG No data
1182031410_1182031416 6 Left 1182031410 22:27162198-27162220 CCATGGTGCCCACTTCATGCACA No data
Right 1182031416 22:27162227-27162249 GAGGCTTTTTGCTTTTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182031416 Original CRISPR GAGGCTTTTTGCTTTTTGCC TGG Intergenic
No off target data available for this crispr