ID: 1182033015

View in Genome Browser
Species Human (GRCh38)
Location 22:27174902-27174924
Sequence CAGAGCAGGGAGAAGAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182033004_1182033015 5 Left 1182033004 22:27174874-27174896 CCTTGGTGTAGCTCACCCTTCCC No data
Right 1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG No data
1182033001_1182033015 13 Left 1182033001 22:27174866-27174888 CCAGATCCCCTTGGTGTAGCTCA No data
Right 1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG No data
1182033002_1182033015 7 Left 1182033002 22:27174872-27174894 CCCCTTGGTGTAGCTCACCCTTC No data
Right 1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG No data
1182032999_1182033015 30 Left 1182032999 22:27174849-27174871 CCAGAAGCTGGAGGGCTCCAGAT No data
Right 1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG No data
1182033003_1182033015 6 Left 1182033003 22:27174873-27174895 CCCTTGGTGTAGCTCACCCTTCC No data
Right 1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG No data
1182033008_1182033015 -10 Left 1182033008 22:27174889-27174911 CCCTTCCCGGGCACAGAGCAGGG No data
Right 1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182033015 Original CRISPR CAGAGCAGGGAGAAGAGGGA TGG Intergenic
No off target data available for this crispr