ID: 1182033230

View in Genome Browser
Species Human (GRCh38)
Location 22:27176511-27176533
Sequence AGCGTGAAGTAGAATGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182033230_1182033237 27 Left 1182033230 22:27176511-27176533 CCGTCCTCATTCTACTTCACGCT No data
Right 1182033237 22:27176561-27176583 TTCTTTCCTTCACCAGCATATGG No data
1182033230_1182033234 1 Left 1182033230 22:27176511-27176533 CCGTCCTCATTCTACTTCACGCT No data
Right 1182033234 22:27176535-27176557 ATGTTATGCCACACATAGAGGGG No data
1182033230_1182033233 0 Left 1182033230 22:27176511-27176533 CCGTCCTCATTCTACTTCACGCT No data
Right 1182033233 22:27176534-27176556 CATGTTATGCCACACATAGAGGG No data
1182033230_1182033232 -1 Left 1182033230 22:27176511-27176533 CCGTCCTCATTCTACTTCACGCT No data
Right 1182033232 22:27176533-27176555 TCATGTTATGCCACACATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182033230 Original CRISPR AGCGTGAAGTAGAATGAGGA CGG (reversed) Intergenic
No off target data available for this crispr