ID: 1182034123

View in Genome Browser
Species Human (GRCh38)
Location 22:27184110-27184132
Sequence GACAGATTCCACCTTGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182034123_1182034132 26 Left 1182034123 22:27184110-27184132 CCACCATCAAGGTGGAATCTGTC No data
Right 1182034132 22:27184159-27184181 TGGCCAATGAACATGGTAAAGGG No data
1182034123_1182034131 25 Left 1182034123 22:27184110-27184132 CCACCATCAAGGTGGAATCTGTC No data
Right 1182034131 22:27184158-27184180 CTGGCCAATGAACATGGTAAAGG No data
1182034123_1182034126 6 Left 1182034123 22:27184110-27184132 CCACCATCAAGGTGGAATCTGTC No data
Right 1182034126 22:27184139-27184161 TCCCGTTCCTTGAACAGAGCTGG No data
1182034123_1182034130 19 Left 1182034123 22:27184110-27184132 CCACCATCAAGGTGGAATCTGTC No data
Right 1182034130 22:27184152-27184174 ACAGAGCTGGCCAATGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182034123 Original CRISPR GACAGATTCCACCTTGATGG TGG (reversed) Intergenic
No off target data available for this crispr