ID: 1182045703

View in Genome Browser
Species Human (GRCh38)
Location 22:27272431-27272453
Sequence CACTGCCCCAACCAGCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182045701_1182045703 -5 Left 1182045701 22:27272413-27272435 CCTGGGTTCAAATCCTGACACTG No data
Right 1182045703 22:27272431-27272453 CACTGCCCCAACCAGCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182045703 Original CRISPR CACTGCCCCAACCAGCTGTG TGG Intergenic
No off target data available for this crispr