ID: 1182049621

View in Genome Browser
Species Human (GRCh38)
Location 22:27302747-27302769
Sequence TGTACCTCCTAAAACCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182049616_1182049621 5 Left 1182049616 22:27302719-27302741 CCTCATCTGTAAAATGGGCCCAA 0: 2
1: 42
2: 337
3: 1946
4: 5756
Right 1182049621 22:27302747-27302769 TGTACCTCCTAAAACCTGGTGGG No data
1182049612_1182049621 19 Left 1182049612 22:27302705-27302727 CCGAGCCTCAGTTTCCTCATCTG 0: 72
1: 475
2: 1262
3: 2356
4: 3845
Right 1182049621 22:27302747-27302769 TGTACCTCCTAAAACCTGGTGGG No data
1182049613_1182049621 14 Left 1182049613 22:27302710-27302732 CCTCAGTTTCCTCATCTGTAAAA 0: 820
1: 4098
2: 9933
3: 17082
4: 22900
Right 1182049621 22:27302747-27302769 TGTACCTCCTAAAACCTGGTGGG No data
1182049611_1182049621 20 Left 1182049611 22:27302704-27302726 CCCGAGCCTCAGTTTCCTCATCT 0: 80
1: 582
2: 1549
3: 3056
4: 4952
Right 1182049621 22:27302747-27302769 TGTACCTCCTAAAACCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182049621 Original CRISPR TGTACCTCCTAAAACCTGGT GGG Intergenic
No off target data available for this crispr