ID: 1182051018

View in Genome Browser
Species Human (GRCh38)
Location 22:27313005-27313027
Sequence CTGAATTAGGTTCAGGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182051018_1182051027 17 Left 1182051018 22:27313005-27313027 CCCTACCCCTGAACCTAATTCAG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1182051027 22:27313045-27313067 CAATACAAGGTCTGAGCCAAAGG 0: 1
1: 0
2: 2
3: 5
4: 109
1182051018_1182051026 4 Left 1182051018 22:27313005-27313027 CCCTACCCCTGAACCTAATTCAG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1182051026 22:27313032-27313054 AGAACAGAGAGAGCAATACAAGG 0: 1
1: 0
2: 3
3: 53
4: 627

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182051018 Original CRISPR CTGAATTAGGTTCAGGGGTA GGG (reversed) Intergenic
902514312 1:16981471-16981493 CTGGATTAGATGCAGGGCTAAGG - Intergenic
902808793 1:18876575-18876597 CTGAAACAGGGGCAGGGGTAGGG + Intronic
905806603 1:40881751-40881773 ATGAATTTGGTGCAGGGCTAGGG - Intergenic
907935981 1:59042628-59042650 CTGAATCAGTTTCAAGGGAATGG - Intergenic
909002066 1:70230120-70230142 CTGTATTATGTTCAGGGATTGGG - Intronic
909888959 1:80978928-80978950 CTGAATTAGGTTTTGGCTTAAGG + Intergenic
915470895 1:156125214-156125236 CTCAAGTAGGCTGAGGGGTAGGG + Intronic
915982091 1:160426538-160426560 CTGTATTGGGTTGAGGGGCAAGG + Exonic
924316358 1:242801799-242801821 CTTAATCAGGTTCAGGGGAGAGG - Intergenic
1067435178 10:46272091-46272113 CTGAGTCAGGGTCAGGGGTCTGG - Intergenic
1067438539 10:46295225-46295247 CTGAGTCAGGGTCAGGGGTCTGG + Intronic
1067461277 10:46460389-46460411 CTTAAGTAGGATCAGGGGCAGGG - Intergenic
1067581061 10:47446339-47446361 CTGAGTCAGGGTCGGGGGTATGG + Intergenic
1067625918 10:47924212-47924234 CTTAAGTAGGATCAGGGGCAGGG + Intergenic
1069694865 10:70379300-70379322 ATGATTTAGGCTTAGGGGTACGG - Intronic
1070740940 10:78902872-78902894 CTGAGTTTGGTACAGGGGAATGG - Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1075779274 10:125006341-125006363 CTGCATGAGGTGCAGGGATATGG + Intronic
1076961501 10:133765574-133765596 CTGGGTTAGGTTTAGGGTTAGGG + Intergenic
1078387334 11:10903968-10903990 CTGATTTGGGTTCATAGGTAAGG + Intergenic
1089613028 11:119680193-119680215 CTGAGCCAAGTTCAGGGGTAAGG - Intronic
1090679976 11:129045008-129045030 ATGAATTAGGTTTAGGTATATGG + Intronic
1093575191 12:20719639-20719661 CTGAATTAGGTTTTGGCTTAAGG - Intronic
1093684300 12:22038957-22038979 CTGGATTAGGGTCAGGGTTAAGG - Intergenic
1098570944 12:71986684-71986706 CAGAACTGGGTGCAGGGGTAGGG - Intronic
1100200962 12:92297390-92297412 CTGGGTTAGGATCTGGGGTAGGG - Intergenic
1104093863 12:125538321-125538343 AAGAATTAGGGTCAGGGTTAGGG + Intronic
1106649660 13:31676651-31676673 CTGAATCAGGATCAGGTGAAAGG - Intergenic
1108041839 13:46346506-46346528 CTGTATTAAGTCCAGGGGGATGG - Intronic
1108690190 13:52852488-52852510 CTGAATTTGAATCAGGGCTATGG - Intergenic
1112209792 13:97364328-97364350 CTGAGTTAGGACCAGGGCTAAGG - Intronic
1113079613 13:106504513-106504535 CGGAATAAGGTTCATGTGTAGGG - Intronic
1115766629 14:36629601-36629623 CTTAATTTATTTCAGGGGTAAGG - Intergenic
1116828698 14:49696604-49696626 CTGAGTTAGGCTCAGGCCTAAGG + Intronic
1121458568 14:94055396-94055418 CTGAACCAGGGTCAGGGGCATGG - Intronic
1125099549 15:35895305-35895327 CTGGATTAGGTTCTGGCTTAAGG + Intergenic
1125759164 15:42085240-42085262 CTGGATTCGGTTCAGGGACAAGG + Intronic
1129826562 15:78638485-78638507 CTGAAGAAGGCTCAGGGGTCAGG - Intronic
1134826265 16:17286908-17286930 CTGAATTCTGTTCAGGTGTTTGG + Intronic
1138451363 16:57095038-57095060 ATGAATAAGGTTCAGGGGAGGGG - Intronic
1139233161 16:65306815-65306837 CTGAACTATGTTCAGGGCTGGGG + Intergenic
1143811134 17:9472714-9472736 GTGAATGAAGTTCAGGGGAAAGG + Intronic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1146466526 17:33090755-33090777 CTGAGGTAGGTGCAGGGGTCTGG + Intronic
1146620343 17:34392143-34392165 CTGAATAAGGTGCAGGAGTAGGG - Intergenic
1152128227 17:78460148-78460170 CTGAATAAGGTAAAGGGGGAGGG - Exonic
1152964835 18:105387-105409 CTGGGTTAGGTTTAGGGTTAGGG - Intergenic
1160272205 18:77397319-77397341 CTGAATTAGGCTGAGGGGCTGGG - Intergenic
1161467113 19:4437191-4437213 CTGCAGGAGGTTCAGGGGTGGGG - Intronic
1161490794 19:4560022-4560044 CTTAGTTAGGTTCTGGGGTAGGG - Intergenic
1163554270 19:17983516-17983538 CAGAACTAGGGTTAGGGGTATGG + Intronic
938186161 2:129233856-129233878 ATGAATTAGATTTAGGGTTAGGG + Intergenic
940218178 2:151322525-151322547 CTGAATTAAGGTAAGGGCTAAGG + Intergenic
941590428 2:167414015-167414037 CTCTATTAGGTTCATGGCTAAGG + Intergenic
945155528 2:206833711-206833733 CTGAATTAGGGTAAGGGAGACGG + Intergenic
945306854 2:208266703-208266725 CCTAATTAAGTTCAGGCGTAAGG - Intronic
947855146 2:233318944-233318966 GTGAATTAGGTACAGGAGTGTGG - Intronic
948383344 2:237566716-237566738 CTGCACTAGGTTCTGGGGTGAGG - Intronic
948385407 2:237577743-237577765 CTGCATTAGGGTCAGGGTTTGGG - Intronic
1170007947 20:11689191-11689213 TTGAATTAGATTGAGGAGTAGGG - Intergenic
1170095626 20:12642830-12642852 CTGATTTAGACTCTGGGGTAAGG + Intergenic
1172070019 20:32249977-32249999 CTGAATTATGTTCCAGTGTATGG + Intergenic
1174534937 20:51244008-51244030 CTGCACTAAGTTCTGGGGTAAGG - Intergenic
1179829075 21:43984816-43984838 CTGAATTAAGCTCAGAAGTAGGG - Exonic
1181540226 22:23569056-23569078 CTGAATGAGATCCAGGGGTGAGG - Intergenic
1182051018 22:27313005-27313027 CTGAATTAGGTTCAGGGGTAGGG - Intergenic
1183426856 22:37744672-37744694 CTGAGTGAGGTGCAAGGGTAGGG + Intronic
949192398 3:1266235-1266257 GAGAATTAGGTTCAGTGATAAGG - Intronic
950112152 3:10426131-10426153 CTGAATTAGGTACAGAGGCAGGG - Intronic
951816597 3:26761855-26761877 CTGAATTTGGATCAGAGGTCTGG - Intergenic
954209867 3:49089767-49089789 CTAAACTAGGTTAAGGGCTACGG + Intronic
956187835 3:66579372-66579394 ATGAATTAGATCCAGAGGTATGG + Intergenic
958517327 3:95134417-95134439 CTCAAATAGGTTCAGAGGAAAGG - Intergenic
960486230 3:118256128-118256150 GTGAGTGAAGTTCAGGGGTAGGG - Intergenic
963931742 3:151010512-151010534 CTGACTGTGGTTCAGGGGCATGG - Intergenic
963981476 3:151543194-151543216 AAGTATTAGGTTCAGGGGTCTGG + Intergenic
964870425 3:161307903-161307925 CTGAATTAGGTTTTGGCTTAAGG - Intergenic
964909433 3:161760559-161760581 ATGAATTAGGTTTAGGTTTAAGG - Intergenic
966031424 3:175352793-175352815 CTGAATTACATTTATGGGTATGG + Intronic
966309241 3:178575288-178575310 GTGAGTTGGGTTCTGGGGTAGGG + Intronic
969321776 4:6417050-6417072 CTGGCTTAGGTTCAGGGGCCCGG - Intronic
969592004 4:8127431-8127453 ATGAATCAGCTTCAGGGGTCTGG - Intronic
971914699 4:32852296-32852318 TTGAATTAGGTTCATAGGAAAGG - Intergenic
974990546 4:69082546-69082568 CTGGATTAGGGTTAGGGTTAAGG - Intronic
976466555 4:85376108-85376130 GTGAATGAGGTTTAGGGGAATGG - Intergenic
976922430 4:90456151-90456173 ATGATTTAAGTTCAGGGGTGGGG + Intronic
982165492 4:152610039-152610061 CTGAATTAGACTCTGGGGCAGGG + Intergenic
985464595 4:190182422-190182444 CTGGGTTAGGTTTAGGGTTAGGG + Intronic
985464730 4:190183056-190183078 CTGGGTTAGGTTTAGGGTTAGGG + Intronic
986565911 5:9114093-9114115 CTGAATAAGATTCAGTTGTATGG - Intronic
987385755 5:17327654-17327676 CTGAATTACGTTCAAGGGATGGG + Intergenic
988157792 5:27477139-27477161 TAGGATTAGGTTCAGGGGAAGGG + Intergenic
988525951 5:31987685-31987707 CTGGAGTGGGTTCAGCGGTATGG - Intronic
988700796 5:33672699-33672721 CTGAATTTGGTTCAGGAATGTGG - Intronic
988740403 5:34063826-34063848 AGGAAGTAGGTTCAGAGGTAAGG + Intronic
988903030 5:35754381-35754403 CTGAAGTAGGTTAGAGGGTATGG + Intronic
990541030 5:56772358-56772380 CTGACTTAATTCCAGGGGTAGGG - Intergenic
994656438 5:102599804-102599826 CTGACCTAGGTTCATGGGGAAGG - Intergenic
995477354 5:112561751-112561773 CTGGGTTAGGGTCAGGGGTGTGG - Intergenic
997211227 5:132078082-132078104 CTGAAACAGGTTCAGGGCTCTGG - Intergenic
1003576311 6:7299178-7299200 CTGAATTTTCTTCTGGGGTAGGG + Intronic
1004236494 6:13879288-13879310 AGGAATTAGATTCAGAGGTAAGG - Intergenic
1005891055 6:30138701-30138723 CTGGATTAGGGTCAGGGGAAAGG - Intronic
1006749251 6:36366414-36366436 CTAAATGAGGTACAGGGGAATGG - Exonic
1007020723 6:38518168-38518190 CTGAAGTTGGTTCGGGGGTGGGG - Intronic
1009923637 6:70093963-70093985 TTGAAATAGGTTCAGAGCTAAGG - Intronic
1010946648 6:81982080-81982102 CTGGATCATGTTCAGGGGGAAGG - Intergenic
1013067122 6:106694683-106694705 CTGAGGTAGGTGAAGGGGTAAGG - Intergenic
1014647932 6:123998031-123998053 CTCAATTAGTTTCTGGGGTTGGG + Intronic
1015963852 6:138677925-138677947 CTGATGTAAGTTAAGGGGTATGG + Intronic
1020812803 7:12865914-12865936 GTGTATTTAGTTCAGGGGTAAGG - Intergenic
1021918579 7:25460358-25460380 CAGAATTGGGTTGGGGGGTAAGG + Intergenic
1021999310 7:26209817-26209839 CTGAATTAGGTTCTAGGCTCAGG + Intronic
1022500871 7:30881770-30881792 CTGAATTTGTTTGAGGGGTGTGG + Intronic
1028853381 7:95562216-95562238 ATGAACTTTGTTCAGGGGTAAGG - Intergenic
1029360597 7:100085896-100085918 CTTGCTTAGGTTTAGGGGTAAGG + Intergenic
1030869669 7:114739780-114739802 CTGAATTGGCTTCAGTGGCAAGG + Intergenic
1032891657 7:136201174-136201196 GTGAATAAGGTTTAGGGGCAGGG - Intergenic
1037428643 8:18785475-18785497 CTGGATTAGGTTTTGGTGTAAGG + Intronic
1051542723 9:18238097-18238119 CTGACTTAGATTCAGAGGTCTGG + Intergenic
1055078846 9:72246711-72246733 CTGCATTGGGGTAAGGGGTAAGG + Intronic
1058935532 9:109766337-109766359 CTAAATGTGGTTCAGGTGTAGGG + Intronic
1185923503 X:4120658-4120680 TTGAGTTGGGTTCAGGGGGATGG - Intergenic
1188022839 X:25177065-25177087 CTGAATCAGATTCTGGGGGACGG + Intergenic
1192183095 X:68928627-68928649 CTGAGTTAGGCTCAGGGTTCGGG - Intergenic
1194717749 X:97306541-97306563 CTGAATTTGGTTCAGAGATAAGG - Intronic
1194751700 X:97692599-97692621 TTTAATAAGCTTCAGGGGTATGG - Intergenic
1196940341 X:120769584-120769606 CAGAATTAGGGGGAGGGGTAAGG + Intergenic
1197449026 X:126588250-126588272 CTGAATTAGGACCATGGGGATGG - Intergenic
1198104309 X:133447930-133447952 CTGTATCGGGTTCAGGGGGAAGG + Intergenic
1201219872 Y:11758355-11758377 CTTAATCAGGTTCAGGGGAGAGG - Intergenic