ID: 1182064340

View in Genome Browser
Species Human (GRCh38)
Location 22:27419882-27419904
Sequence CTCTTGGAATTTCAGATGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182064335_1182064340 26 Left 1182064335 22:27419833-27419855 CCAATATTTAGAGATGGGGAGAT No data
Right 1182064340 22:27419882-27419904 CTCTTGGAATTTCAGATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182064340 Original CRISPR CTCTTGGAATTTCAGATGTT TGG Intergenic
No off target data available for this crispr