ID: 1182066714

View in Genome Browser
Species Human (GRCh38)
Location 22:27436284-27436306
Sequence CAGAATCTGGAGACAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182066708_1182066714 6 Left 1182066708 22:27436255-27436277 CCCTGTGAAGTCAGATTCTGAAA No data
Right 1182066714 22:27436284-27436306 CAGAATCTGGAGACAATGGAAGG No data
1182066709_1182066714 5 Left 1182066709 22:27436256-27436278 CCTGTGAAGTCAGATTCTGAAAT No data
Right 1182066714 22:27436284-27436306 CAGAATCTGGAGACAATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182066714 Original CRISPR CAGAATCTGGAGACAATGGA AGG Intergenic
No off target data available for this crispr