ID: 1182068722

View in Genome Browser
Species Human (GRCh38)
Location 22:27448266-27448288
Sequence CCTCATCTGCAGACTGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182068711_1182068722 23 Left 1182068711 22:27448220-27448242 CCCTTAACCCCTGCATTGTTTGG No data
Right 1182068722 22:27448266-27448288 CCTCATCTGCAGACTGAGCAGGG No data
1182068719_1182068722 14 Left 1182068719 22:27448229-27448251 CCTGCATTGTTTGGGGGTCAATT No data
Right 1182068722 22:27448266-27448288 CCTCATCTGCAGACTGAGCAGGG No data
1182068713_1182068722 22 Left 1182068713 22:27448221-27448243 CCTTAACCCCTGCATTGTTTGGG No data
Right 1182068722 22:27448266-27448288 CCTCATCTGCAGACTGAGCAGGG No data
1182068718_1182068722 15 Left 1182068718 22:27448228-27448250 CCCTGCATTGTTTGGGGGTCAAT No data
Right 1182068722 22:27448266-27448288 CCTCATCTGCAGACTGAGCAGGG No data
1182068717_1182068722 16 Left 1182068717 22:27448227-27448249 CCCCTGCATTGTTTGGGGGTCAA No data
Right 1182068722 22:27448266-27448288 CCTCATCTGCAGACTGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182068722 Original CRISPR CCTCATCTGCAGACTGAGCA GGG Intergenic
No off target data available for this crispr