ID: 1182068982

View in Genome Browser
Species Human (GRCh38)
Location 22:27450174-27450196
Sequence GACCCCACTGGGATTTCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182068976_1182068982 26 Left 1182068976 22:27450125-27450147 CCAGGTTGAGGATGTGTAGCTTC No data
Right 1182068982 22:27450174-27450196 GACCCCACTGGGATTTCCCTAGG No data
1182068975_1182068982 29 Left 1182068975 22:27450122-27450144 CCTCCAGGTTGAGGATGTGTAGC No data
Right 1182068982 22:27450174-27450196 GACCCCACTGGGATTTCCCTAGG No data
1182068977_1182068982 4 Left 1182068977 22:27450147-27450169 CCCTCAAAAATATCAAAGAACTC No data
Right 1182068982 22:27450174-27450196 GACCCCACTGGGATTTCCCTAGG No data
1182068978_1182068982 3 Left 1182068978 22:27450148-27450170 CCTCAAAAATATCAAAGAACTCC No data
Right 1182068982 22:27450174-27450196 GACCCCACTGGGATTTCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182068982 Original CRISPR GACCCCACTGGGATTTCCCT AGG Intergenic
No off target data available for this crispr