ID: 1182071164

View in Genome Browser
Species Human (GRCh38)
Location 22:27464741-27464763
Sequence CTGGCCACACTGAGCTACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182071158_1182071164 9 Left 1182071158 22:27464709-27464731 CCTGCACCTCATTGACCAAAATT No data
Right 1182071164 22:27464741-27464763 CTGGCCACACTGAGCTACAAGGG No data
1182071161_1182071164 -6 Left 1182071161 22:27464724-27464746 CCAAAATTGTAAGTCACCTGGCC No data
Right 1182071164 22:27464741-27464763 CTGGCCACACTGAGCTACAAGGG No data
1182071159_1182071164 3 Left 1182071159 22:27464715-27464737 CCTCATTGACCAAAATTGTAAGT No data
Right 1182071164 22:27464741-27464763 CTGGCCACACTGAGCTACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182071164 Original CRISPR CTGGCCACACTGAGCTACAA GGG Intergenic
No off target data available for this crispr