ID: 1182073588

View in Genome Browser
Species Human (GRCh38)
Location 22:27479810-27479832
Sequence CTGGGGGTGTGGTGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182073588_1182073601 14 Left 1182073588 22:27479810-27479832 CCATCCTCCCACCACACCCCCAG No data
Right 1182073601 22:27479847-27479869 AAATCTACCTTCTGTCTCTATGG 0: 2
1: 20
2: 204
3: 776
4: 1368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182073588 Original CRISPR CTGGGGGTGTGGTGGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr