ID: 1182073823

View in Genome Browser
Species Human (GRCh38)
Location 22:27481203-27481225
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182073823_1182073828 -2 Left 1182073823 22:27481203-27481225 CCAAGCAGGGCCAATATATGTGG No data
Right 1182073828 22:27481224-27481246 GGTCCCAGGAGGTCAAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182073823 Original CRISPR CCACATATATTGGCCCTGCT TGG (reversed) Intergenic
No off target data available for this crispr