ID: 1182076292

View in Genome Browser
Species Human (GRCh38)
Location 22:27497671-27497693
Sequence TTCTGGGCCTCTCTTAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182076288_1182076292 -7 Left 1182076288 22:27497655-27497677 CCAGCCCATCAGCTCTTTCTGGG No data
Right 1182076292 22:27497671-27497693 TTCTGGGCCTCTCTTAAGAGAGG No data
1182076282_1182076292 30 Left 1182076282 22:27497618-27497640 CCTCAGCTTTCCAAAGCACAGGC No data
Right 1182076292 22:27497671-27497693 TTCTGGGCCTCTCTTAAGAGAGG No data
1182076283_1182076292 20 Left 1182076283 22:27497628-27497650 CCAAAGCACAGGCATGAGCCACC No data
Right 1182076292 22:27497671-27497693 TTCTGGGCCTCTCTTAAGAGAGG No data
1182076284_1182076292 2 Left 1182076284 22:27497646-27497668 CCACCATGCCCAGCCCATCAGCT No data
Right 1182076292 22:27497671-27497693 TTCTGGGCCTCTCTTAAGAGAGG No data
1182076286_1182076292 -6 Left 1182076286 22:27497654-27497676 CCCAGCCCATCAGCTCTTTCTGG No data
Right 1182076292 22:27497671-27497693 TTCTGGGCCTCTCTTAAGAGAGG No data
1182076285_1182076292 -1 Left 1182076285 22:27497649-27497671 CCATGCCCAGCCCATCAGCTCTT No data
Right 1182076292 22:27497671-27497693 TTCTGGGCCTCTCTTAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182076292 Original CRISPR TTCTGGGCCTCTCTTAAGAG AGG Intergenic
No off target data available for this crispr