ID: 1182076349

View in Genome Browser
Species Human (GRCh38)
Location 22:27498064-27498086
Sequence AGGGGCCACTGCGCAGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182076349_1182076355 23 Left 1182076349 22:27498064-27498086 CCTGAAGCTGCGCAGTGGCCCCT No data
Right 1182076355 22:27498110-27498132 AGCCCCCTAGAAGATGCTAGTGG No data
1182076349_1182076360 30 Left 1182076349 22:27498064-27498086 CCTGAAGCTGCGCAGTGGCCCCT No data
Right 1182076360 22:27498117-27498139 TAGAAGATGCTAGTGGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182076349 Original CRISPR AGGGGCCACTGCGCAGCTTC AGG (reversed) Intergenic
No off target data available for this crispr