ID: 1182078496

View in Genome Browser
Species Human (GRCh38)
Location 22:27511733-27511755
Sequence ATGGAGAAACAGGTTCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182078496_1182078502 9 Left 1182078496 22:27511733-27511755 CCTCCCTGAACCTGTTTCTCCAT No data
Right 1182078502 22:27511765-27511787 GGCGAATATTCCTCCTTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182078496 Original CRISPR ATGGAGAAACAGGTTCAGGG AGG (reversed) Intergenic
No off target data available for this crispr