ID: 1182078502

View in Genome Browser
Species Human (GRCh38)
Location 22:27511765-27511787
Sequence GGCGAATATTCCTCCTTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182078497_1182078502 6 Left 1182078497 22:27511736-27511758 CCCTGAACCTGTTTCTCCATCAG No data
Right 1182078502 22:27511765-27511787 GGCGAATATTCCTCCTTCATAGG No data
1182078496_1182078502 9 Left 1182078496 22:27511733-27511755 CCTCCCTGAACCTGTTTCTCCAT No data
Right 1182078502 22:27511765-27511787 GGCGAATATTCCTCCTTCATAGG No data
1182078493_1182078502 29 Left 1182078493 22:27511713-27511735 CCACCTGGAGCCAGCTCAAACCT No data
Right 1182078502 22:27511765-27511787 GGCGAATATTCCTCCTTCATAGG No data
1182078499_1182078502 -1 Left 1182078499 22:27511743-27511765 CCTGTTTCTCCATCAGTAACATG No data
Right 1182078502 22:27511765-27511787 GGCGAATATTCCTCCTTCATAGG No data
1182078498_1182078502 5 Left 1182078498 22:27511737-27511759 CCTGAACCTGTTTCTCCATCAGT No data
Right 1182078502 22:27511765-27511787 GGCGAATATTCCTCCTTCATAGG No data
1182078495_1182078502 19 Left 1182078495 22:27511723-27511745 CCAGCTCAAACCTCCCTGAACCT No data
Right 1182078502 22:27511765-27511787 GGCGAATATTCCTCCTTCATAGG No data
1182078501_1182078502 -10 Left 1182078501 22:27511752-27511774 CCATCAGTAACATGGCGAATATT No data
Right 1182078502 22:27511765-27511787 GGCGAATATTCCTCCTTCATAGG No data
1182078494_1182078502 26 Left 1182078494 22:27511716-27511738 CCTGGAGCCAGCTCAAACCTCCC No data
Right 1182078502 22:27511765-27511787 GGCGAATATTCCTCCTTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182078502 Original CRISPR GGCGAATATTCCTCCTTCAT AGG Intergenic
No off target data available for this crispr