ID: 1182079077

View in Genome Browser
Species Human (GRCh38)
Location 22:27516410-27516432
Sequence CTGGGCTGGCTTACATTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182079077 Original CRISPR CTGGGCTGGCTTACATTTCC AGG (reversed) Intergenic
900976114 1:6017472-6017494 CTGGGCTGGTCTAGAATTCCAGG + Intronic
901947434 1:12715195-12715217 CTGTGCTTGCTTGCCTTTCCAGG - Intergenic
904353590 1:29924496-29924518 CTGGCCTGGCTTCCATCCCCTGG + Intergenic
906326122 1:44847204-44847226 GTGGGCTGCCTCACTTTTCCTGG - Intergenic
907025995 1:51119581-51119603 CTGGGCTGGTTTCCAGTTCCTGG - Intronic
907641409 1:56194016-56194038 CTGGGCTCACCTACATTTCAGGG - Intergenic
910745910 1:90574856-90574878 CTGGGCTTGCTGACATGTCTGGG + Intergenic
910927303 1:92410292-92410314 GTGGTCAAGCTTACATTTCCAGG + Intergenic
911251034 1:95576471-95576493 CTGGTCTGCCTTCCTTTTCCTGG + Intergenic
913614225 1:120540986-120541008 CCAGGCTGGCTTACGATTCCTGG - Intergenic
914576042 1:148969913-148969935 CCAGGCTGGCTTACGATTCCTGG + Intronic
915022639 1:152796245-152796267 CTGGGCCGGGTTATACTTCCAGG + Intronic
915567159 1:156721602-156721624 CTGGGCTGGATTTAAATTCCTGG + Intergenic
917520606 1:175745361-175745383 CTGAGGTGGCTTACTTTTTCTGG + Intergenic
918003452 1:180520103-180520125 CTGGGCTAGCTCCCATCTCCAGG - Intergenic
920313678 1:205063030-205063052 TAGCACTGGCTTACATTTCCCGG - Intronic
922754219 1:228085874-228085896 CTGGCCTGCCTCCCATTTCCTGG + Intronic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1063061779 10:2563198-2563220 CTGGGCTCACTTACATGTCTAGG + Intergenic
1064009209 10:11722060-11722082 CTGGGCTGGTTAATCTTTCCAGG - Intergenic
1066243932 10:33563623-33563645 CTGGGCTGACTTACATCGCCTGG - Intergenic
1069659748 10:70115953-70115975 CTGGACTGGCTTCCTTTTCCTGG + Intronic
1069996156 10:72343352-72343374 CAGGGCTGGCTTACCTTTGAAGG + Exonic
1072844514 10:98815056-98815078 CTGGGCTGGTCTAGAATTCCTGG - Intronic
1073029233 10:100511558-100511580 CCAGGCTGGCTTCCATCTCCTGG - Intronic
1075253371 10:120903121-120903143 TTGTGCTGGCTGACTTTTCCTGG - Exonic
1076469773 10:130710295-130710317 ATGGGCTGGCACACCTTTCCTGG - Intergenic
1078797825 11:14610976-14610998 CTGAGCTGCATAACATTTCCAGG + Exonic
1078922300 11:15842002-15842024 CTGGGCAGGCTTCCAGATCCCGG + Intergenic
1080340244 11:31254672-31254694 CTGGGCTTGCTCACATGTCTTGG + Intronic
1080613683 11:33927284-33927306 CTGGGCTGTCTCACATATCTGGG + Intergenic
1081296768 11:41399953-41399975 TTGGGTTAGCTTACATGTCCTGG - Intronic
1081521375 11:43884963-43884985 CTGGGCTGGTTTCGAATTCCTGG + Intronic
1081916534 11:46735100-46735122 CTGGGCTGGTTTTGAATTCCTGG - Intronic
1082023812 11:47556659-47556681 CTGGGCTGGTTTTGAATTCCTGG - Intronic
1082800112 11:57408350-57408372 CTGGGCTGGTTTTGAATTCCTGG - Intronic
1086938545 11:92770405-92770427 CTGTGCTTGCTTTCATTTCAAGG + Intronic
1087148067 11:94831864-94831886 CTAGGCTGCCTTCCATTTCCTGG - Intronic
1089837761 11:121386344-121386366 CTGGGCTCTCTCACATGTCCAGG - Intergenic
1092102929 12:5901121-5901143 CTGGGTTTGCTAACATCTCCAGG - Intronic
1092204203 12:6605992-6606014 CTGGGCTGGCAGGCATTACCTGG - Intronic
1092393583 12:8104269-8104291 CTGAGGTGGCTTACAATTCAAGG - Intergenic
1093527332 12:20117053-20117075 CTGGACTGGCTTAGTCTTCCGGG - Intergenic
1098383268 12:69891884-69891906 CTGGGCTGGGCTTCAATTCCTGG + Intronic
1101260126 12:103020459-103020481 CTTGGCTTGCTTACATGTCTTGG - Intergenic
1103104400 12:118210342-118210364 CTTGGCTGGCTCACAATTCCTGG + Intronic
1103818986 12:123682179-123682201 CTAGGCTGGTCTACAATTCCTGG + Intronic
1103984358 12:124757469-124757491 CTGGGCTCGCTTGCATGTCTGGG - Intergenic
1105496534 13:20935610-20935632 CTGGGCTGGCCTCCAACTCCTGG - Intergenic
1106017729 13:25885024-25885046 CTGAGCTGGCCTCCATGTCCTGG + Intronic
1106916819 13:34524642-34524664 TTTGGGTGGCTTACATTTCAAGG + Intergenic
1110142604 13:72149345-72149367 GTGGGCTGGCTAAGAATTCCAGG + Intergenic
1110874931 13:80497200-80497222 CTGGGCTTGCTCACATGTCTGGG + Intergenic
1112802217 13:103125015-103125037 CTGGGTTGGGTTTGATTTCCAGG - Intergenic
1113331417 13:109331660-109331682 CTGGCATGGCTTGCAATTCCAGG - Intergenic
1113464752 13:110505485-110505507 CTGGGCGGGCTCCCATTTGCTGG - Intronic
1113570879 13:111356602-111356624 GTTGGCTGGATAACATTTCCTGG + Intergenic
1113627409 13:111857058-111857080 CTGGTCTGGCGTGGATTTCCCGG - Intergenic
1115447160 14:33504252-33504274 GTGAGCTGACTTACATTGCCAGG + Intronic
1117459124 14:55927264-55927286 CTGGTCTGTTTTGCATTTCCAGG - Intergenic
1118567055 14:67153087-67153109 CTGGGCTGGTTTAGAACTCCTGG - Intronic
1118992232 14:70808257-70808279 CTGAGCTGGCTCACAAGTCCCGG - Intronic
1122343554 14:101044353-101044375 ATGGCCTGGCTTCCATGTCCGGG + Intergenic
1122405799 14:101500244-101500266 CTGGGCTGGCTGCCCTTGCCCGG - Intergenic
1122687005 14:103513665-103513687 TTTTGCTGGCTTGCATTTCCTGG + Intergenic
1122889369 14:104725307-104725329 ATGGGCTGACTTACAGCTCCAGG + Intronic
1123012451 14:105356022-105356044 CTGCGCTGGCTGACCTTCCCAGG - Intronic
1123447945 15:20343469-20343491 CTGGGCTGGCTTGGCTTGCCGGG - Intergenic
1125284319 15:38075454-38075476 CAGGGCTGGAATTCATTTCCTGG - Intergenic
1127567559 15:60207269-60207291 ATGAGATGGGTTACATTTCCTGG + Intergenic
1128694468 15:69750155-69750177 CTGGGCTGGCTTCCACTTTCGGG + Intergenic
1129906702 15:79192709-79192731 CTGGGCTTGCATACAGTTGCTGG - Intergenic
1131220049 15:90576192-90576214 CTAGGCTGGCCTCAATTTCCTGG - Intronic
1137806721 16:51313497-51313519 CTGGGCTGGCTCACACGTCTGGG - Intergenic
1138422084 16:56905437-56905459 CTGGCCTCTCCTACATTTCCTGG + Intronic
1140273593 16:73487956-73487978 CTGGGCTTGCTTAGATGTCTGGG - Intergenic
1142059717 16:88021340-88021362 CTGGGCTTGCTCACAGTGCCCGG + Intronic
1142350088 16:89575803-89575825 CTGGGCCGGCCACCATTTCCCGG + Exonic
1144773467 17:17772086-17772108 TGAGTCTGGCTTACATTTCCTGG - Intronic
1147037477 17:37692528-37692550 CTTTTCTAGCTTACATTTCCTGG - Intronic
1150596754 17:66613046-66613068 CAGGGATTGCTTATATTTCCAGG + Intronic
1154198944 18:12286180-12286202 CTAGGCTGGCCTCCATCTCCTGG - Intergenic
1158989264 18:62852087-62852109 CTGGGCTGGCCTCAATCTCCTGG + Intronic
1159971935 18:74666034-74666056 CTGAGCTGGCTTCCATTCTCAGG - Intronic
1162835068 19:13311298-13311320 CTGGGCTGGTTTTCAACTCCTGG + Intronic
1163938061 19:20468493-20468515 CTGTGCTGGCTTACTTTACTTGG + Intergenic
1165971148 19:39631246-39631268 CTGGGCTGGCTTTGAACTCCTGG - Intergenic
1166515046 19:43440184-43440206 CCAGGCTGGCTTTCAATTCCTGG - Intergenic
925381627 2:3431361-3431383 CTGGGCTGGATGATGTTTCCTGG - Intronic
925436232 2:3840222-3840244 CCGAGCTGGTTTACATTTGCTGG + Intronic
930745482 2:54878662-54878684 CTTGTCTGCTTTACATTTCCAGG - Intronic
931161033 2:59690895-59690917 CTTTCCTGGCTTACATTTCATGG - Intergenic
931340993 2:61400638-61400660 CTGGGCTGGCTTTGAGCTCCTGG - Intronic
933776322 2:85773399-85773421 CAGGGCTGGCTTCCAGTTGCCGG - Intronic
934868666 2:97839113-97839135 CTAGGCTGGCCTACAACTCCTGG - Intronic
935428523 2:102946962-102946984 CTTTGCTAACTTACATTTCCAGG - Intergenic
936036868 2:109120249-109120271 CTGGCCTGGCTTACCCTGCCAGG + Intergenic
936907302 2:117551678-117551700 CTGAGCAGCCTTACAGTTCCAGG - Intergenic
937967958 2:127528451-127528473 CTTGGCTGCCTTACATTTTCAGG + Intergenic
938114709 2:128595207-128595229 CTGGCCTGGCTTGTATTTCCCGG + Intergenic
938238660 2:129725893-129725915 CTGAGCTTGCTAACATCTCCCGG - Intergenic
941207134 2:162587992-162588014 CATGGCTGGCTTTCATTTCTTGG - Intronic
946366074 2:219249867-219249889 CTGGGCTGGCCCAGAGTTCCTGG - Exonic
947615168 2:231551494-231551516 CTTGGCAGGATGACATTTCCTGG - Intergenic
1170780116 20:19417878-19417900 CAGGTCTGGCTTTCATTTCTGGG - Intronic
1170876003 20:20250869-20250891 CTGCACTGGCTTCCATTTTCTGG - Intronic
1172605210 20:36209340-36209362 CTGGGGTGTTTTTCATTTCCTGG + Intronic
1175222322 20:57424448-57424470 CTGGACTGGCTGACCCTTCCTGG + Intergenic
1176154399 20:63610984-63611006 CTGGGCTCACTTGCATATCCGGG - Intronic
1176160639 20:63646102-63646124 CTGTCCTGACTTAAATTTCCTGG + Intronic
1179298003 21:40080486-40080508 CCAGGCTGGGTTACATTTCCTGG - Intronic
1180412647 22:12629322-12629344 CTAGGCTGGCTTCCAACTCCTGG - Intergenic
1180659061 22:17449872-17449894 CTGGAGTGACTGACATTTCCGGG - Intronic
1180788220 22:18558638-18558660 CTGGGCTGGATTACATGGCTGGG - Intergenic
1181233518 22:21436680-21436702 CTGGGCTGGATTACATGGCTGGG + Intronic
1181245132 22:21498163-21498185 CTGGGCTGGATTACATGGCTGGG - Intergenic
1181618992 22:24074981-24075003 CTGGGCTGGCTTCAAACTCCTGG - Intronic
1182079077 22:27516410-27516432 CTGGGCTGGCTTACATTTCCAGG - Intergenic
1184051261 22:42006607-42006629 CTTGGCATGATTACATTTCCAGG + Intronic
1184499828 22:44864939-44864961 AGGGGATGGCTTACATGTCCTGG + Intergenic
1184614184 22:45626677-45626699 ATGGGCTGGGTCTCATTTCCAGG + Intergenic
1184876045 22:47276259-47276281 ATGTGCTGGCTCACATTTCTGGG - Intergenic
1185170518 22:49291096-49291118 CTTGGCTGGCTTCCTTCTCCCGG + Intergenic
1185307372 22:50127516-50127538 CTGGGATGGCTTCCAGCTCCGGG - Intronic
954330477 3:49887338-49887360 CGGGGCCGGCGTACATTCCCTGG + Exonic
955288758 3:57670875-57670897 CTGTGATGGGTTAGATTTCCAGG - Intronic
955358792 3:58254595-58254617 ATGGCCTTCCTTACATTTCCTGG - Intronic
955661261 3:61301901-61301923 CTGGAATGGCTTGCATTTCAAGG - Intergenic
960672312 3:120165574-120165596 CTGAGCTGGCTGTCATGTCCAGG - Exonic
960950608 3:122996370-122996392 CTGGGCTGCCTTTCATACCCTGG + Intronic
961007358 3:123413893-123413915 CTGGGCTGGGGTGCAGTTCCTGG - Intronic
962121441 3:132564965-132564987 CTGTGCTCACTGACATTTCCAGG - Intronic
962327748 3:134449923-134449945 TTGGGCTGGCTGAGATTTTCCGG + Intergenic
963479945 3:145859791-145859813 CTGGACTGACTCACATATCCTGG - Intergenic
965554448 3:170005023-170005045 CTGGGCTGTCGGATATTTCCTGG - Intergenic
967739349 3:192987853-192987875 CTGGGCCAGCTGACATTTCTAGG - Intergenic
968660094 4:1795312-1795334 CGGGGCTGGCTGACATTCCCGGG - Intronic
969305019 4:6320876-6320898 CTGGCTCTGCTTACATTTCCTGG - Exonic
969369917 4:6724969-6724991 CTGTGCAGGCTTTCCTTTCCTGG - Intergenic
977495421 4:97769360-97769382 CTGGGCTTGCTCACATGTCTGGG - Intronic
981306491 4:143252151-143252173 CTGGGATGGATAACATTTACCGG - Intergenic
982169559 4:152647892-152647914 CTTGGTTGGCTTGCACTTCCTGG - Intronic
983081283 4:163387940-163387962 CTGGGCTGGGTTACACTTTATGG - Intergenic
990359784 5:55007093-55007115 CTTTGCTGGGTTACTTTTCCTGG - Intronic
990973612 5:61537362-61537384 CTGGGCTGCCTTGCAATACCTGG - Intronic
996603696 5:125296034-125296056 CTAGGCTGGCTTTGAATTCCTGG - Intergenic
1002153511 5:177256490-177256512 CTGGGCTGGCCTCGACTTCCTGG + Intronic
1003788491 6:9515237-9515259 CAATGCTGGCCTACATTTCCAGG - Intergenic
1006103871 6:31704155-31704177 CTGGGCTGGCTTGGAACTCCAGG - Intronic
1009247893 6:61262205-61262227 CTATGCTGGATTACATTTACCGG + Intergenic
1010774478 6:79869586-79869608 CTGGGCTGTCGTACTTTACCTGG + Intergenic
1011507309 6:88060219-88060241 CTATGATGGCTTACATATCCAGG + Intronic
1012157046 6:95832287-95832309 TTTGGCTGGCTTACTTTTTCAGG - Intergenic
1016066681 6:139690424-139690446 CTAGGCTGGCTTCGAATTCCTGG + Intergenic
1017834096 6:158161164-158161186 CTGGGCTGGCCTAGAGCTCCTGG - Intronic
1019033688 6:169035463-169035485 CTGGGCTGGCTCAGCATTCCGGG - Intergenic
1019408046 7:894195-894217 CTGAGGTGTCTTCCATTTCCTGG + Intronic
1020136707 7:5591994-5592016 CTGGTCTGGCTCACAGTTGCTGG + Intergenic
1021592564 7:22279922-22279944 TTGGGATGGCCTCCATTTCCAGG + Intronic
1021611239 7:22460098-22460120 CTGGGCTGGTTTCAAATTCCTGG - Intronic
1025169030 7:56739523-56739545 CTAGGCTGGTTTTCAATTCCAGG - Intergenic
1025703361 7:63840367-63840389 CTAGGCTGGTTTTCAATTCCAGG + Intergenic
1027629242 7:80581616-80581638 CTGGGCTGGCTCACACCTCTAGG - Intronic
1029947499 7:104548679-104548701 CTGGGCTGGCTAACAAATCCAGG - Intronic
1034649483 7:152678292-152678314 CTAGGCTGGTTTACAACTCCTGG + Intergenic
1034896197 7:154877947-154877969 CTGGGCCGGCTTCCGTGTCCTGG - Intronic
1035544741 8:471249-471271 CAGGGATGGCTTACATTGCTGGG + Intergenic
1035653186 8:1284224-1284246 CACTGCAGGCTTACATTTCCAGG + Intergenic
1036095599 8:5721751-5721773 CTGGGCTGGCCTAAAACTCCTGG - Intergenic
1037740187 8:21602648-21602670 ATGGGCTGGCTTTCATTTCCAGG + Intergenic
1037771135 8:21800713-21800735 CTGGGCTGGCCTCCAACTCCTGG - Intronic
1038049861 8:23798446-23798468 CTGGGGAGCCTGACATTTCCAGG - Intergenic
1038740915 8:30215906-30215928 CTAGGCTTGCTTACATTTTTGGG + Intergenic
1044014578 8:87035763-87035785 CCGGGCTGCCATACATTGCCTGG - Intronic
1049567127 8:143346570-143346592 CCAGGCTGGCTTCCAGTTCCCGG - Intronic
1050891923 9:10835555-10835577 CTGGGGTGAATGACATTTCCTGG + Intergenic
1052675210 9:31613434-31613456 TTGGGCCTGCTCACATTTCCTGG - Intergenic
1052796555 9:32928508-32928530 CTTGGAGGGCTTACATCTCCAGG - Intergenic
1052847110 9:33346536-33346558 CTGGGCTCCCTCACACTTCCTGG - Intronic
1053267098 9:36723417-36723439 CTGTTCTTGCTTCCATTTCCAGG - Intergenic
1056680588 9:88714318-88714340 TTGGCCTGGCCTACATTTCTGGG + Intergenic
1059373037 9:113858728-113858750 CAGGGCTTGCTTACATATCTGGG - Intergenic
1059473684 9:114526671-114526693 CTGGTCTGGCTTGCATGTCCTGG - Intergenic
1060606122 9:124915638-124915660 CTGGGCTGGTTTTGATCTCCTGG - Intronic
1187476642 X:19617052-19617074 CTGGGGTGGCTCAAATTTTCAGG - Intronic
1187580895 X:20606084-20606106 CTGTACTAACTTACATTTCCAGG - Intergenic
1189256030 X:39640067-39640089 CTGGACTTGCTTACATTTCTGGG - Intergenic
1189347926 X:40256329-40256351 TTGGGCTGGGTTGCATTTGCAGG + Intergenic
1192148167 X:68695352-68695374 CTGGGCTGGTTTTCATTTTAGGG + Intronic
1192786845 X:74344530-74344552 GTGGGCTGGCTGATCTTTCCTGG - Intergenic
1198223204 X:134621923-134621945 GTGGGCTGGCTTCCATCTCCAGG - Intronic