ID: 1182080138

View in Genome Browser
Species Human (GRCh38)
Location 22:27522956-27522978
Sequence GGTTATCTGGAGAAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 395}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182080138 Original CRISPR GGTTATCTGGAGAAGGAGGT GGG Intergenic
901469201 1:9443918-9443940 GGGTAAGGGGAGAAGGAGGTGGG - Intergenic
901911475 1:12462242-12462264 GGTGATGGGGAGAAGGAGGGTGG + Intronic
902206347 1:14870970-14870992 TGATATCTGGAGAATGAGGAAGG + Intronic
902730450 1:18365443-18365465 GGTTGGCTGGAGGAGGATGTTGG - Exonic
902784165 1:18722282-18722304 GGTTATATGGGGAAGGGGTTGGG - Intronic
902824117 1:18961047-18961069 GGTTGTCTGGGGCAGGGGGTAGG - Intergenic
902963691 1:19982527-19982549 GGGTATCTGGAGTAGGAGGATGG + Intergenic
903004497 1:20289746-20289768 TCTTGTGTGGAGAAGGAGGTAGG + Intergenic
903271548 1:22191711-22191733 AGTTGTCTGGAGAAGGAGTCTGG + Intergenic
903290419 1:22310217-22310239 GGTTGCCTGGAGAAGAGGGTGGG + Intergenic
904035705 1:27557383-27557405 AGCTCTCTGGGGAAGGAGGTGGG - Intronic
904400329 1:30252539-30252561 GGTCGCCTGGAGAAGGAGGAGGG + Intergenic
905465224 1:38148097-38148119 AGTTATCTGAAGAAGATGGTAGG - Intergenic
905789267 1:40781826-40781848 GGTAATCTGGAGCTGGAGTTGGG + Intergenic
905808773 1:40896754-40896776 AGTTAACTGGACAAGGAGGCTGG + Intergenic
905816224 1:40953040-40953062 GTTTCTCTGGAGGAGAAGGTGGG - Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906136959 1:43506548-43506570 AGTGATGTGGAGAAGGAGCTTGG - Intergenic
907088248 1:51699325-51699347 GGGTATGTGGAGAAGGAGAGGGG - Intronic
907510497 1:54954483-54954505 AGTTCTCTGGATAAGGAGGAGGG + Intergenic
909482711 1:76142754-76142776 GGTTATCTGGAGAATGCAATAGG + Intronic
909869568 1:80722657-80722679 GTTTCTCAGGAGCAGGAGGTGGG + Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
911833542 1:102585380-102585402 GGAGATCTGGAGAAGGATGTTGG + Intergenic
912941096 1:114045575-114045597 GTTTTTGAGGAGAAGGAGGTAGG + Intergenic
913522294 1:119656339-119656361 GGTTTTCTGAGGAAGGAGCTAGG + Intergenic
914446841 1:147757763-147757785 GGTGATCAGGTCAAGGAGGTAGG + Exonic
915070931 1:153266236-153266258 GGTTACCAGGAGCTGGAGGTGGG - Intergenic
916016846 1:160757342-160757364 GCTGATCTGGAAAAGGAGGTGGG + Intergenic
916559360 1:165919970-165919992 GGTTCCCTGGAGTAGGAGGGAGG - Intergenic
916649502 1:166821726-166821748 GGCTTCCTGGAGCAGGAGGTGGG - Intergenic
917118655 1:171626562-171626584 CCTCAGCTGGAGAAGGAGGTGGG - Intergenic
918409325 1:184242343-184242365 GGGTATCTGGGGAAGGAGAAAGG - Intergenic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918961077 1:191278774-191278796 GGTTGTCAGGAGATGGAGGAGGG - Intergenic
919483634 1:198119774-198119796 GGTTATGGAGAGAAGGAGGATGG - Intergenic
919688530 1:200507425-200507447 GCTACTCTGGAGACGGAGGTGGG - Intergenic
919977686 1:202623402-202623424 GAGTCTCTGGAGAAGGAGGTGGG - Intronic
920711226 1:208296803-208296825 TGTCTTCTGGAGAAGGGGGTGGG + Intergenic
922697161 1:227736238-227736260 GGGTGTCTGGAGAAGATGGTGGG + Intronic
923548356 1:234941316-234941338 GGTAATGTGGAGATGGAGGTAGG - Intergenic
923976534 1:239270726-239270748 CCTGATCAGGAGAAGGAGGTAGG - Intergenic
924847864 1:247790911-247790933 GGTTAGCTGGATAAAGAGGAGGG - Intergenic
1062907657 10:1189729-1189751 CGTGTTCTGGGGAAGGAGGTAGG - Intronic
1063267323 10:4467969-4467991 TGTGCTATGGAGAAGGAGGTAGG - Intergenic
1063309836 10:4941705-4941727 GATTTTCCAGAGAAGGAGGTTGG + Intronic
1063317453 10:5020397-5020419 GATTTTCCAGAGAAGGAGGTTGG - Intronic
1063994663 10:11608385-11608407 GGTTATGTGGAGAAGGCCCTTGG - Intronic
1064288514 10:14013075-14013097 GGTGAGCTGGAGAAAGAGATGGG + Intronic
1064836504 10:19537513-19537535 GAATATCTGGAGAAAGAGGAGGG - Intronic
1064860182 10:19817355-19817377 GGTTATCAAGAGAAGGACGCCGG + Intronic
1065412877 10:25449581-25449603 GGTTACCAGGGGTAGGAGGTGGG + Intronic
1066562777 10:36688837-36688859 GGTTCTCAGGAGAAGGAGCCAGG + Intergenic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1067630297 10:47959080-47959102 GGCCTTCTGGAGAAGGAGGCAGG + Intergenic
1068290752 10:54999350-54999372 TGTTATTTGGAAAAGTAGGTAGG + Intronic
1069395974 10:67988307-67988329 GGTTATCTTGTGAAAGAGATTGG - Intronic
1069691967 10:70359620-70359642 GGATATCTAGAAAGGGAGGTGGG - Intronic
1070372592 10:75797555-75797577 GGTTATCTAGAGTTGGGGGTAGG - Intronic
1070490178 10:76968775-76968797 GGTGATATGGAAAAGGAGTTGGG + Intronic
1070683280 10:78464074-78464096 TGATAGCTGGAGAGGGAGGTGGG + Intergenic
1072116343 10:92373903-92373925 GACTATCTGGAGGGGGAGGTGGG - Intergenic
1072319354 10:94233601-94233623 TATTATCTGGGGAAGTAGGTGGG + Intronic
1072426007 10:95331480-95331502 GGGTTTCTGGAGAAGGGGCTGGG - Intronic
1073035752 10:100563106-100563128 GGAGAGCTGGAGATGGAGGTTGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1074043112 10:109811790-109811812 GGTTGCCTGGAGCTGGAGGTTGG + Intergenic
1074318640 10:112380890-112380912 GGTACTCAGGAGAATGAGGTAGG - Intronic
1074713094 10:116193694-116193716 GGTAATCTGGGGAGGCAGGTTGG - Intronic
1074851194 10:117440859-117440881 TGTTTTCTAGAGATGGAGGTGGG + Intergenic
1074974947 10:118572606-118572628 GGGGATGTGGAGAAGGAGATGGG - Intergenic
1075742872 10:124706402-124706424 GGTCATCTGGTGAATGAGGAGGG - Intronic
1078143953 11:8710581-8710603 GGTTATCTGGAGTAAGGGGAGGG - Intronic
1082095452 11:48126022-48126044 GGTTAGTTGGAGGAGGAGGAAGG + Intronic
1082933682 11:58634782-58634804 AGTTATGTGGAGATGGAGGAGGG - Intergenic
1083307866 11:61770249-61770271 GGTTATCGTGCGCAGGAGGTGGG - Exonic
1085272515 11:75278604-75278626 GCCTCTCTGGATAAGGAGGTAGG - Exonic
1086488085 11:87330044-87330066 GGTTATCTGGATAAAGATGGAGG - Intergenic
1086515024 11:87601833-87601855 GGTTAAATGGAGAAGGACGAGGG - Intergenic
1089286176 11:117409500-117409522 TGTTGTCTGGAGAAGCAGGGAGG + Intronic
1089623167 11:119734432-119734454 AGTTATCTGCAGAGAGAGGTTGG + Intergenic
1091126821 11:133107501-133107523 GGTTGTCTGGATAAATAGGTTGG - Intronic
1091387276 12:103332-103354 GGGGCTCAGGAGAAGGAGGTGGG + Intronic
1091622399 12:2099288-2099310 GGTTCTCTGCAGAAGGATCTAGG - Intronic
1092771356 12:11899941-11899963 GTTTACCTGGGGATGGAGGTGGG + Intergenic
1092856644 12:12680616-12680638 GGTCCTCGGGAGACGGAGGTAGG - Intronic
1093709891 12:22318568-22318590 GCTTAGCTTGAGAAGGAGGCAGG - Intronic
1094360904 12:29629648-29629670 GGTTATCAGGGGATGGAGGAGGG + Intronic
1095823682 12:46508801-46508823 GGTGATCAGGAGAAGGATCTGGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1100316034 12:93445304-93445326 GGTTACCTGGAGCAGGTTGTGGG + Intergenic
1101182407 12:102233545-102233567 GGTTTTCTGGAGAGGGAGGGAGG + Intergenic
1102800638 12:115730305-115730327 TGTTATCTGGGGAAGGAGTGGGG - Intergenic
1103292670 12:119859926-119859948 GCTACTCTGGAGAATGAGGTGGG - Intronic
1103676792 12:122662267-122662289 GGTTACCGGGAGCTGGAGGTGGG - Intergenic
1103855108 12:123962493-123962515 GGTTAGCTGGATAAGGGGCTTGG + Intronic
1104450505 12:128864784-128864806 GGTGAGCTGGAGAAGGAGTGTGG + Intronic
1106656464 13:31752243-31752265 AGTCATCTGAAGAAGGAGGGGGG + Intronic
1109141725 13:58720367-58720389 GATTATCTGGAGATGGATATAGG + Intergenic
1111936111 13:94558399-94558421 AGTTATCTGGTGACAGAGGTAGG + Intergenic
1112370844 13:98792076-98792098 GAGTATCTGGAGATGGAGGGTGG + Intergenic
1112666699 13:101583378-101583400 GTTTTTCTGGAGGGGGAGGTGGG + Intronic
1114312154 14:21477267-21477289 GGTTGTGTGAAGATGGAGGTAGG + Exonic
1114798524 14:25743895-25743917 GCTTCTCTGGAGACTGAGGTGGG - Intergenic
1115447621 14:33509612-33509634 GGAGACCTGGAGGAGGAGGTGGG + Intronic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1118230726 14:63946314-63946336 GCTTCTCTGGAGACTGAGGTGGG + Intronic
1118667757 14:68088805-68088827 GCGTAACTGAAGAAGGAGGTTGG + Intronic
1119747581 14:77055176-77055198 GATTTCCTGGAGAGGGAGGTTGG + Intergenic
1119858259 14:77917111-77917133 GTTTTTCTGGAGGATGAGGTGGG + Intronic
1119877050 14:78069837-78069859 GGTCATGTGAAGATGGAGGTAGG + Intergenic
1121704952 14:95984749-95984771 AGTCATCTGGAGTAGTAGGTAGG - Intergenic
1121878539 14:97477890-97477912 GCTTCTCTGGAAATGGAGGTGGG - Intergenic
1122633326 14:103118139-103118161 GGCTGTTTGGAGAAGGAAGTCGG - Intergenic
1122741591 14:103874738-103874760 GGGTGTCTGCAGAAGGAGGCTGG + Intergenic
1124406217 15:29394657-29394679 GGTTTTCTGGAGATGGATGAGGG - Intronic
1124493334 15:30171766-30171788 GAGTCTCTGGAGAAGGAGGTGGG - Intergenic
1124750200 15:32366559-32366581 GAGTCTCTGGAGAAGGAGGTGGG + Intergenic
1124783604 15:32658832-32658854 GGATCTCTGGAGATGAAGGTAGG + Intronic
1125484935 15:40105324-40105346 GGGGAACTGGAGAAAGAGGTTGG - Intronic
1125710637 15:41782936-41782958 GGAAATCTGGAGCTGGAGGTGGG - Intronic
1129359208 15:75013925-75013947 GGTGATCTGTAGCAGGGGGTGGG + Intronic
1129963261 15:79709478-79709500 GCTTATTTAGAGAAGGAAGTTGG - Intergenic
1130700996 15:86181492-86181514 GGCTGTCTGGAGATGGGGGTTGG + Intronic
1131498652 15:92937991-92938013 GATTGTGTAGAGAAGGAGGTAGG + Intronic
1131837804 15:96408510-96408532 GTTTATTTAAAGAAGGAGGTGGG - Intergenic
1132110472 15:99099061-99099083 TATTATATGGATAAGGAGGTGGG + Intronic
1132538880 16:498283-498305 GGTCCTCAGGAGGAGGAGGTGGG - Intronic
1132761116 16:1509102-1509124 GAGTCTCTGGGGAAGGAGGTGGG - Intronic
1133828270 16:9298290-9298312 GGAGCTCTGGAGAATGAGGTGGG - Intergenic
1134333472 16:13271710-13271732 GGTTGCCTGGAGCTGGAGGTGGG + Intergenic
1134370939 16:13623964-13623986 GGTTCTCTGGACATGGAGGTGGG + Intergenic
1135463661 16:22666456-22666478 GGTTGCCTGGAGCTGGAGGTTGG - Intergenic
1136118433 16:28111775-28111797 GGACAGCTGGGGAAGGAGGTAGG - Intronic
1136871563 16:33812331-33812353 GGTCAGCTGGAGCACGAGGTGGG - Intergenic
1138302567 16:55944762-55944784 GGGTATCTGGAGAGGGCAGTAGG - Intronic
1140095632 16:71873349-71873371 GGTAAAATGGGGAAGGAGGTAGG + Intronic
1141587769 16:85046404-85046426 GGTTATGTGGGAAAGGAGGTGGG - Intronic
1141949655 16:87332363-87332385 GGTTAGCTGGGGACGGAGGCTGG + Intronic
1142404956 16:89883334-89883356 GTTTATCTGGAAAAACAGGTTGG - Exonic
1203100609 16_KI270728v1_random:1303727-1303749 GGTCAGCTGGAGCACGAGGTGGG + Intergenic
1143137086 17:4718006-4718028 GCTTCCCTGGACAAGGAGGTGGG + Exonic
1143714162 17:8755167-8755189 GGGAACCTGGAGAAGGAGGATGG + Intronic
1143758871 17:9086867-9086889 GGTGATATTGAGAAGGAGGTGGG - Intronic
1144270756 17:13613490-13613512 GGTGATCTTTTGAAGGAGGTGGG + Intergenic
1145325585 17:21821128-21821150 TGTTAACTGGACAGGGAGGTGGG + Intergenic
1147441732 17:40451718-40451740 GCTGAGCTGGAGAAAGAGGTTGG - Intronic
1147607443 17:41782260-41782282 GCTTTTCTGGTGATGGAGGTGGG - Intronic
1148208191 17:45792634-45792656 GGCTTCCTGGAGGAGGAGGTGGG - Intronic
1148625570 17:49066598-49066620 GAAGATCTGGAGAGGGAGGTTGG + Intergenic
1149341742 17:55693784-55693806 GGTTAACTGGACAACGAGTTAGG - Intergenic
1150813635 17:68376220-68376242 GGTACTCAGGAGAATGAGGTGGG - Intronic
1151140134 17:71983798-71983820 GTGTTTCTGGAGAAGGAGTTGGG - Intergenic
1151458697 17:74241979-74242001 TGTTCTCTGGAGAAGCAGGAGGG + Intronic
1152509784 17:80778685-80778707 GCTTCTCGGGAGAAGGAGGCAGG + Intronic
1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG + Intergenic
1153133210 18:1881693-1881715 GGATTTATGAAGAAGGAGGTTGG + Intergenic
1153555912 18:6313030-6313052 GTTTACTTGGAGCAGGAGGTAGG - Intronic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154406553 18:14097047-14097069 GGTTTGATGGAGAAGGTGGTTGG - Intronic
1155663484 18:28279264-28279286 GGTTACCAGGAGCTGGAGGTTGG - Intergenic
1156620939 18:38850834-38850856 AGTGATGTGGAGAAGGAGGGTGG - Intergenic
1157239301 18:45994996-45995018 GGCTATCTGGGGAAGGAGGAAGG - Intronic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157350188 18:46877183-46877205 GCTTATCTGAATAAGGTGGTGGG - Intronic
1157437889 18:47686616-47686638 GGGTTGCTGGAGATGGAGGTGGG - Intergenic
1157453255 18:47803695-47803717 TGGCAGCTGGAGAAGGAGGTTGG - Intergenic
1159626630 18:70702838-70702860 GATTATATGGATATGGAGGTTGG + Intergenic
1159897665 18:74012292-74012314 GGTTACCTGGAGAAGGACCGCGG + Intergenic
1160419344 18:78733380-78733402 GGTGAAGTGGAGAAGGTGGTAGG - Intergenic
1160582871 18:79897628-79897650 GGGTATGTGGAGGAGGAGGAGGG - Intronic
1161149846 19:2702096-2702118 GGTTAGCTGGGGAGGGAGCTTGG - Intronic
1161230429 19:3172325-3172347 GGGGATCTGGAGAGGGATGTGGG - Intronic
1162007254 19:7788591-7788613 GGTGCCCTGGAGGAGGAGGTGGG + Intergenic
1162139713 19:8578438-8578460 GGTCATCTAAAGAGGGAGGTTGG - Intergenic
1162241821 19:9361380-9361402 TTTTTTCTGGAGAGGGAGGTTGG - Intronic
1162310981 19:9907070-9907092 TGTTGACTGGAGATGGAGGTGGG - Intronic
1162541100 19:11296472-11296494 GGTTCCCTGGAGAAGCAGGAGGG + Intronic
1163607947 19:18286030-18286052 GGTTTCTTGGAGAAGGTGGTGGG - Intergenic
1163830743 19:19546079-19546101 GGCTGTCTGGAGAAGAAGGAGGG - Exonic
1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG + Intergenic
1164790248 19:30971453-30971475 GAGAGTCTGGAGAAGGAGGTGGG - Intergenic
1164819291 19:31232716-31232738 GGTTAACTGGAGCAGGGGGTAGG - Intergenic
1166136021 19:40777800-40777822 GATTATCTGGAAAGGGAGGTGGG + Intronic
1168277928 19:55287329-55287351 GGTAACCTGGAGAGGGAGGATGG - Intronic
1168337255 19:55603664-55603686 GGTCCTCAGGACAAGGAGGTGGG - Intergenic
925386263 2:3463879-3463901 GCTTCTCTGGGGAAGGAAGTAGG - Intronic
925551010 2:5074427-5074449 GGCTATCAGGAGAAGGAAGATGG - Intergenic
925623791 2:5821483-5821505 GGTCACCTGGGGGAGGAGGTAGG - Intergenic
926446466 2:12948511-12948533 TGTGATCTGGAGCAGGAGGAGGG + Intergenic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
927211472 2:20641589-20641611 GGTTCACGGGAGAATGAGGTTGG - Intronic
928959773 2:36912148-36912170 GATAATCTGAAGAAGGTGGTAGG - Intronic
929929677 2:46243221-46243243 GGTCACCTGGAGATGAAGGTAGG - Intergenic
931465755 2:62485335-62485357 GGTTTTCGGGAGAAAGAAGTGGG - Intergenic
931689235 2:64821236-64821258 GGAGCTCTGAAGAAGGAGGTAGG - Intergenic
931979580 2:67680124-67680146 GGGTTTCTGGAGAAGGCTGTGGG - Intergenic
934576478 2:95404877-95404899 TATTATCTGGAGAGGCAGGTGGG + Intronic
934638703 2:96013046-96013068 TATTATCTGGAGAGGCAGGTGGG + Intergenic
935839098 2:107089451-107089473 AGTTTTCTGGAGAAGGTGGTGGG - Intergenic
935918645 2:107986261-107986283 AGTTTTCTGGAGGAGGAGATGGG + Intergenic
938552322 2:132393618-132393640 GGTGATCAGGAGCATGAGGTGGG - Intergenic
939446127 2:142311844-142311866 GGTGATCTGGAAAAAGATGTTGG - Intergenic
940124252 2:150306688-150306710 CAGTATCTGGAGAAGGAGATAGG - Intergenic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943242572 2:185404691-185404713 GTTATTCTGGAGAAGGAGTTTGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943716284 2:191155556-191155578 GGTGAGCTGGAGTTGGAGGTTGG + Intergenic
944005341 2:194897669-194897691 GGTTATCAGGAGAACTAGCTGGG + Intergenic
944089952 2:195895715-195895737 GGCAATCTGGGGATGGAGGTAGG - Intronic
944815205 2:203369142-203369164 GGTTTTCTGTAGAAGGAGGGAGG + Intronic
945610415 2:211994240-211994262 GGTACTCAGGAGAATGAGGTAGG - Intronic
945689603 2:213016955-213016977 TGTTATCAAGAGAAGGAGGAAGG + Intronic
946185417 2:217978279-217978301 GGATAAATGGAGAATGAGGTCGG - Intronic
946695098 2:222348813-222348835 GCTGCTCTGGAAAAGGAGGTGGG - Intergenic
946955606 2:224927020-224927042 TGTTATCAAGAGAAGCAGGTGGG + Intronic
1169423138 20:5475468-5475490 GGAGAGCTGGAAAAGGAGGTGGG - Intergenic
1170661677 20:18347480-18347502 TTTCCTCTGGAGAAGGAGGTAGG - Intergenic
1171295831 20:24016037-24016059 TGTTGTCTGGAGAAGGTGATAGG - Intergenic
1172206328 20:33165404-33165426 TGTTATCTGGAGAAGGGGTGGGG + Intronic
1172433692 20:34913537-34913559 GGGGCTCTGGAGAAGTAGGTTGG + Intronic
1173265159 20:41472459-41472481 GGGTATGTGGTGAAGAAGGTGGG - Intronic
1173844515 20:46179380-46179402 GGTCGTCTGGGGAAGGAGCTGGG - Intronic
1174104084 20:48149707-48149729 GGTGAACTGGAGAGGGAGGTGGG + Intergenic
1174468681 20:50738700-50738722 AATTATCTGGAAAATGAGGTGGG + Intronic
1179460314 21:41530170-41530192 ATTTCTCAGGAGAAGGAGGTGGG - Intronic
1180167569 21:46037970-46037992 GGTTTTCTGGAGAATAAAGTGGG - Intergenic
1180167610 21:46038101-46038123 GGCTATCTGGAGGAAGTGGTGGG + Intergenic
1180988468 22:19919496-19919518 GGTGTCCTGGGGAAGGAGGTGGG - Intronic
1181381619 22:22508904-22508926 GGTTAAATTGAGAAGGAGGAGGG + Exonic
1182080138 22:27522956-27522978 GGTTATCTGGAGAAGGAGGTGGG + Intergenic
1182920777 22:34076993-34077015 GGTTACCTGGAGAGGGTGTTCGG + Intergenic
1183548276 22:38467087-38467109 GGTTATCTGTGGCAGGAGGTGGG + Intergenic
1183735636 22:39643392-39643414 GGTAACCTGGAGATGGAGGTGGG + Intronic
1183836619 22:40459389-40459411 GCTTTTCTAGAGAAGGAAGTAGG - Intronic
1184392786 22:44214527-44214549 GGTTGTCTGGAGTAAGAGGCAGG + Intronic
1185184010 22:49381767-49381789 AGTTAACAGGAGAAGGAGGGCGG - Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
950084878 3:10249870-10249892 GTTTCTCTGGAGTAGGAGGCAGG - Intronic
951129211 3:19022011-19022033 GTGTATTTGGAGAAGCAGGTAGG - Intergenic
951800743 3:26593238-26593260 GGTTACCAGGGGCAGGAGGTGGG - Intergenic
951811166 3:26701654-26701676 TGTTGTCTGGAGATGGAGTTGGG - Intronic
953786067 3:45912222-45912244 GTGTATCTGGAGGAGAAGGTGGG + Intronic
954518924 3:51205588-51205610 GGTGCTCTGGAGACTGAGGTAGG + Intronic
955259809 3:57376085-57376107 GCTTATCTGTAAAATGAGGTTGG + Intronic
958868255 3:99526346-99526368 GGGTATTAGGAGTAGGAGGTGGG - Intergenic
959855527 3:111151878-111151900 GGTTATCTGTAGATGGGGGTAGG - Intronic
960570734 3:119182916-119182938 GGTTTTCTGGAAAAGCATGTGGG + Intronic
960583879 3:119303209-119303231 GGTTTTCTGAAGAAGGAAGTAGG - Intronic
960601865 3:119467097-119467119 GGAAATCTGGAGAAAGGGGTAGG - Intronic
960659657 3:120043850-120043872 GTTTAGATGGAGAAGGAGGAGGG - Intronic
960845636 3:122002026-122002048 GCTTCTCTGGAGACCGAGGTGGG + Intronic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
961534392 3:127560810-127560832 GGGTATCTGGGGAAAGAAGTGGG - Intergenic
961616632 3:128187968-128187990 GGTGAGCTGGTGAAGCAGGTTGG + Intronic
962853466 3:139325001-139325023 GTATATCTGGGGATGGAGGTTGG - Intronic
963399791 3:144783592-144783614 GGTTAGCTGAAGTAGGAGGAGGG + Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
963702065 3:148638836-148638858 GGTCATCTGTGGATGGAGGTAGG + Intergenic
964488002 3:157205839-157205861 GGTTTTCTGGAGAAGCAGAGCGG + Intergenic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
966254730 3:177904866-177904888 GGTTTGCTGGAGTGGGAGGTGGG + Intergenic
966480564 3:180403936-180403958 AGTTATCTGCAGAGGGTGGTAGG - Intergenic
966762764 3:183431823-183431845 GGTTCACTGGAGAAGGAAGCAGG - Intergenic
967906715 3:194507660-194507682 GGATGTCAGGAGAAGGAGGTAGG - Intergenic
967931455 3:194693374-194693396 TGTGAACTGGAGAAGGAGGAAGG - Intergenic
967941829 3:194772299-194772321 GGATATATGGAGAAGGGCGTCGG + Intergenic
968799582 4:2733267-2733289 GGTTTGCAGGAGAATGAGGTGGG + Intergenic
969575010 4:8031522-8031544 GGTTGTCTGGAGCAGGAGGCTGG + Intronic
970497374 4:16640277-16640299 AGTTTTTTGGTGAAGGAGGTGGG + Intronic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974808041 4:66907103-66907125 GTTTGACTGGAAAAGGAGGTGGG - Intergenic
976062357 4:81143827-81143849 GGATATGTGGAGGAGGGGGTTGG - Intronic
981333100 4:143535541-143535563 GGTTATCTGTAGAAGGTGGTTGG + Intronic
981890654 4:149732339-149732361 GGTTTTCAGGAGAAGTAGGATGG - Intergenic
981913388 4:150008191-150008213 GGGTAACTGGAGAAGCAGGGAGG - Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
983020719 4:162672484-162672506 GGTTGTCTGGAAATGGAGTTGGG + Intergenic
983405895 4:167329375-167329397 GCTAATCTGGAGACTGAGGTGGG + Intergenic
984272896 4:177569558-177569580 GGTTATCTGGGGAAGGAATTTGG - Intergenic
985305860 4:188538688-188538710 GGTTTCCTGAGGAAGGAGGTGGG - Intergenic
985348726 4:189035326-189035348 GAGTAACTGGAGAATGAGGTGGG - Intergenic
985995187 5:3593775-3593797 AGTGACCTGGAGAATGAGGTGGG - Intergenic
986164624 5:5263308-5263330 GGTTCTCTGAGGCAGGAGGTGGG + Intronic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
989045210 5:37267620-37267642 GGTTATCTGAAGAAGATGGTAGG + Intergenic
990271890 5:54151019-54151041 GGTCATTTGGAGCCGGAGGTTGG - Intronic
991286663 5:64984437-64984459 GGTTAGCTGGAGATGCAGGTGGG + Intronic
991970528 5:72136533-72136555 GGTCTTGGGGAGAAGGAGGTAGG - Intronic
992438828 5:76780581-76780603 GCTACTCTGGAGAATGAGGTGGG + Intergenic
992609157 5:78492454-78492476 GGTTCTCTGGGGAAGCAGGCAGG + Intronic
992613072 5:78524153-78524175 GGTTTTCCTGAGAAGGAGGCTGG - Intronic
992908436 5:81371362-81371384 GGTACTCAGGAGACGGAGGTGGG - Intronic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993588664 5:89765347-89765369 GGTTGTCTGGGGCTGGAGGTGGG - Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996619040 5:125478107-125478129 AGTGATCAGGAGAAGGAGTTTGG - Intergenic
996705092 5:126489670-126489692 GGTGAGCTGGAGAAGAAGATAGG + Intronic
998118809 5:139560013-139560035 GGGTATCTGGAGCACGAGGTTGG + Intronic
998407059 5:141879867-141879889 GGTAATCTGGTGAAAGAGGGGGG + Intergenic
998825134 5:146093766-146093788 GGTTTTCTGGAAAAGGAAGGAGG - Intronic
999598543 5:153234107-153234129 TGTTCCCTGGAGAAGGAGGTGGG - Intergenic
1000654832 5:163864278-163864300 GTTTTTCTGGAGAATGATGTGGG - Intergenic
1002305129 5:178278672-178278694 GGGTATGTGGGGCAGGAGGTAGG - Intronic
1002637872 5:180617114-180617136 GGTGCTCTGGAGTAGGATGTGGG - Intronic
1002637885 5:180617164-180617186 GGTGCTCTGGAGTAGGATGTGGG - Intronic
1002637898 5:180617214-180617236 GGTGCTCTGGAGTAGGACGTGGG - Intronic
1002637921 5:180617314-180617336 GGTGCTCTGGAGTAGGACGTGGG - Intronic
1002637933 5:180617364-180617386 GGTGCTCTGGAGTAGGACGTGGG - Intronic
1002637946 5:180617414-180617436 GGTGCTCTGGAGTAGGATGTGGG - Intronic
1002637959 5:180617464-180617486 GGTGCTCTGGAGTAGGACGTGGG - Intronic
1002637972 5:180617514-180617536 GGTGCTCTGGAGTAGGACGTGGG - Intronic
1002637985 5:180617564-180617586 GGTGCTCTGGAGTAGGACGTGGG - Intronic
1002638011 5:180617664-180617686 GGTGCTCTGGAGTAGGACGTGGG - Intronic
1002638024 5:180617714-180617736 GGTGCTCTGGAGTAGGACGTGGG - Intronic
1002638099 5:180618016-180618038 GGTGCTCTGGAGTAGGATGTGGG - Intronic
1002638166 5:180618268-180618290 GGTGCTCTGGAGTAGGACGTGGG - Intronic
1002638193 5:180618369-180618391 GGTGCTCTGGAGTAGGATGTGGG - Intronic
1002638205 5:180618419-180618441 GGTCCTCTGGAGTAGGACGTGGG - Intronic
1002895773 6:1379298-1379320 GGTATTCTGGAGCAGGAGGGAGG + Intergenic
1003815868 6:9839607-9839629 GGTTACCTGGAGAAACAGGGAGG - Intronic
1003874649 6:10424971-10424993 GGTTTTTTGGAGAAGGAGCAAGG - Intergenic
1004811215 6:19265850-19265872 GGTAAGCAGGAGGAGGAGGTGGG + Intergenic
1006160679 6:32039077-32039099 GCTTGTCTGCAGGAGGAGGTGGG - Exonic
1006509563 6:34514798-34514820 GGGTGGCTGGAGAAGGAGGCGGG + Intronic
1007172503 6:39873546-39873568 TGTCATCTGGGGAAGGAGCTGGG + Intronic
1007176125 6:39898881-39898903 GCAGAACTGGAGAAGGAGGTGGG + Exonic
1008133155 6:47740709-47740731 AGATCTCTGGAGAAGCAGGTTGG + Intergenic
1008507928 6:52248738-52248760 GTATATTTGGAGAAGGAGGCTGG - Intergenic
1008637401 6:53424556-53424578 GGTTATCTGGTGAGGGGGGGAGG + Intergenic
1008918578 6:56817947-56817969 GGTTATCAAAAGAGGGAGGTGGG + Intronic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1010124303 6:72414365-72414387 GGTTTGCTGGGGAAGGAGGGTGG - Intergenic
1010309767 6:74371310-74371332 GGTTCCCTGGAGAAAGAGCTAGG + Intergenic
1010714140 6:79208693-79208715 GCTTACCTGGAGAAGGTGATGGG - Intronic
1011190934 6:84727475-84727497 GGTTATCATGAGAAGGAAATGGG + Intronic
1011428940 6:87264528-87264550 ATTTTTCTGGAAAAGGAGGTAGG + Intergenic
1011499684 6:87974186-87974208 GGGGATTTGGAGAAAGAGGTTGG - Intergenic
1011559634 6:88601414-88601436 GGTTATCATGAGAAGGAGACTGG + Intergenic
1011751684 6:90460710-90460732 GGGGATCCGGAGCAGGAGGTAGG - Intergenic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1013493395 6:110673104-110673126 GGTTATCAGGAGCTGGGGGTAGG - Intronic
1014416983 6:121195361-121195383 GGTTATCTGCAGAAGATGGTAGG - Intronic
1014550331 6:122782783-122782805 GTTTCTGTGGAGATGGAGGTGGG + Intronic
1015307251 6:131723375-131723397 GGTTATCAGGAGCAGTCGGTAGG - Intronic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1015774933 6:136804473-136804495 GATTACCTGGGGAAGGAGGAGGG + Intergenic
1016042136 6:139442327-139442349 GCTTATCACGAGAAGGAGGAAGG + Intergenic
1016122164 6:140357609-140357631 GGTTTCCTGGAGGAGGATGTGGG - Intergenic
1016273430 6:142318807-142318829 GGGTCTCTGCAGAAGAAGGTAGG + Intronic
1016327172 6:142915804-142915826 GGTGGTCTGGAGATGGAAGTGGG - Intronic
1017036710 6:150273689-150273711 TGTTGTCTGGAGAAGGTTGTGGG - Intergenic
1017281603 6:152631734-152631756 GGGTATAGGTAGAAGGAGGTGGG + Intronic
1017364967 6:153625151-153625173 GGTTATAAGGAGTGGGAGGTGGG + Intergenic
1020516644 7:9129670-9129692 GGTTATCAGGAGTGGGAGGGAGG - Intergenic
1020632523 7:10656670-10656692 GGGAGACTGGAGAAGGAGGTGGG + Intergenic
1021378135 7:19934181-19934203 AGTTGTCTGGAGCTGGAGGTTGG + Intergenic
1021675386 7:23075627-23075649 GGCTGTCTGCAGAAGGAGGGAGG + Intergenic
1023909804 7:44545623-44545645 GCTTCTCAGGAGACGGAGGTTGG - Intergenic
1024228851 7:47348719-47348741 TTTGATCTGGAGAAGGAGGATGG + Intronic
1026443582 7:70464744-70464766 GGTTAACTGGAATATGAGGTTGG + Intronic
1026933221 7:74236678-74236700 GCTTCCCTGGAGAAGGAGCTAGG + Intronic
1027241451 7:76332630-76332652 GGTACTCTGGAGATTGAGGTGGG - Intronic
1027862448 7:83602121-83602143 GGTTACCTGGGGAATGAGATGGG + Intronic
1028360652 7:89962829-89962851 GGCTATCTGGAGAAAGAGGCTGG + Intergenic
1028437238 7:90818120-90818142 GGAAATCTGGAGCAGGAGTTGGG - Intronic
1030079848 7:105767854-105767876 GGTGGACTGGAGAAGGAGGAAGG - Intronic
1030609956 7:111678652-111678674 GGGTATCTGGAGATGTAGGCAGG - Intergenic
1031781426 7:125971711-125971733 GGTTTTCTGAAGAGTGAGGTGGG + Intergenic
1031966307 7:128030735-128030757 TTCCATCTGGAGAAGGAGGTGGG + Exonic
1033182879 7:139198127-139198149 GGTACTCTGGAGACGGAGGCAGG - Intergenic
1033561495 7:142536351-142536373 TGTAATAGGGAGAAGGAGGTGGG + Intergenic
1035996468 8:4552799-4552821 GGCTATCCTGTGAAGGAGGTGGG - Intronic
1037779009 8:21855068-21855090 AGTGGTCTGGAGCAGGAGGTGGG - Intergenic
1041697662 8:60753734-60753756 GGTACTCTGGAGGATGAGGTGGG - Intronic
1042829928 8:73015716-73015738 GGTCCTCTGGAGACTGAGGTAGG + Intronic
1043503916 8:80884367-80884389 GTTTATATGGAGGAGGTGGTGGG - Intergenic
1043531046 8:81150243-81150265 GGTAAGCTGGAGGAGGAGGAAGG + Intergenic
1043803574 8:84643026-84643048 GATAATCTGGAGAATGAAGTTGG + Intronic
1044222908 8:89690467-89690489 GGTCATCTGGAGGTAGAGGTAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1044835661 8:96293066-96293088 GGGTGTCTGGGGCAGGAGGTGGG - Intronic
1045344162 8:101279741-101279763 GGCTATCTGAGAAAGGAGGTAGG - Intergenic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1048547370 8:135399778-135399800 GGTTGTCAGGAGAAGGGGTTGGG - Intergenic
1048774615 8:137932084-137932106 GTTTATGTGGAGAAGGCGGGGGG + Intergenic
1048836067 8:138520139-138520161 GGTTTTCTGTACATGGAGGTGGG - Intergenic
1049044103 8:140136102-140136124 AGTGATTTGGAGAGGGAGGTAGG + Intronic
1050174631 9:2856934-2856956 GGGTAAGTGGAGAAGGAGATGGG + Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051559816 9:18428011-18428033 GGATAGGTGGAGAAGGAGGGTGG - Intergenic
1051742651 9:20266438-20266460 AGTTATCTGGAGAATGAGTTAGG - Intergenic
1052718312 9:32145433-32145455 GGTGATAAGGAGAAGGTGGTGGG - Intergenic
1052946617 9:34173546-34173568 GCTACTCTGGAGATGGAGGTGGG + Intergenic
1055148456 9:72964806-72964828 GGTTACCAGGTGAAGGAAGTGGG - Intronic
1055621932 9:78134985-78135007 GGTCAGCTGGAAAAGGAAGTAGG - Intergenic
1056770027 9:89471484-89471506 TGTTATCTGGAGAGTGTGGTGGG - Intronic
1056780382 9:89544602-89544624 TGTGATCTGGAGAGGGAGGCAGG - Intergenic
1056992843 9:91426525-91426547 GGTTCTCAGGAGGAGGAGGAAGG + Intergenic
1057958824 9:99435222-99435244 GGTTGCCTGGGGATGGAGGTGGG - Intergenic
1059037474 9:110771629-110771651 AGTTATGTGAAGAAGTAGGTAGG + Intronic
1059155189 9:111983282-111983304 GGTTTTCTGGAGGAGGAAGATGG + Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1059424156 9:114210454-114210476 GGCTGTCTGGGGAAGGTGGTGGG + Intronic
1061725158 9:132578570-132578592 TGTTACGTGGAGAAGGAGGTGGG + Intergenic
1062376996 9:136266344-136266366 GGTCCTCTGGGGAGGGAGGTGGG + Intergenic
1187433528 X:19246557-19246579 GTTTATCTGTAGAAGGAGACAGG - Intergenic
1187439542 X:19305700-19305722 GGTTGTGTGGGGAGGGAGGTGGG + Intergenic
1188890723 X:35608834-35608856 GGTTACCAGGAGTGGGAGGTGGG + Intergenic
1188908162 X:35812982-35813004 TGTTATATAGAGAGGGAGGTGGG + Intergenic
1189859927 X:45261773-45261795 GTTGATCAGGGGAAGGAGGTAGG + Intergenic
1191111995 X:56811462-56811484 GGGGATCTGGAGAGGCAGGTTGG + Intergenic
1192174953 X:68879669-68879691 GGTGCTTTGGAGCAGGAGGTTGG - Intergenic
1192434205 X:71132696-71132718 AGTAGTCTGGAGAATGAGGTTGG + Intronic
1192874109 X:75210542-75210564 GGTTTTCAGGAAAAGGGGGTTGG + Intergenic
1193337995 X:80313216-80313238 GGTTAAGTTGAGAAGGAAGTGGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194500122 X:94672369-94672391 GCCTGTCTGGGGAAGGAGGTTGG + Intergenic
1195277872 X:103299790-103299812 GGTTCTCAGGAGAAGGCGGCTGG + Intergenic
1195780305 X:108455101-108455123 GGTTATTTGGGGATGGAGGATGG - Intronic
1196637270 X:118017047-118017069 GATTATTTGGGGAAGGAGGACGG - Intronic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197645061 X:129008436-129008458 AGTTACCAGGGGAAGGAGGTTGG + Intergenic
1198737925 X:139807838-139807860 GCTACTCTGGAGATGGAGGTGGG + Intronic
1201620773 Y:15954764-15954786 GGTGACCTGGAGAAGGAGTGTGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic