ID: 1182087723

View in Genome Browser
Species Human (GRCh38)
Location 22:27573209-27573231
Sequence CTGCTCTCAGAACCTGAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182087716_1182087723 30 Left 1182087716 22:27573156-27573178 CCTTTGAGCCCTTCAATTACTCC No data
Right 1182087723 22:27573209-27573231 CTGCTCTCAGAACCTGAAGTCGG No data
1182087719_1182087723 21 Left 1182087719 22:27573165-27573187 CCTTCAATTACTCCATGGTTAAT No data
Right 1182087723 22:27573209-27573231 CTGCTCTCAGAACCTGAAGTCGG No data
1182087718_1182087723 22 Left 1182087718 22:27573164-27573186 CCCTTCAATTACTCCATGGTTAA No data
Right 1182087723 22:27573209-27573231 CTGCTCTCAGAACCTGAAGTCGG No data
1182087720_1182087723 9 Left 1182087720 22:27573177-27573199 CCATGGTTAATCAGACAAACTGC No data
Right 1182087723 22:27573209-27573231 CTGCTCTCAGAACCTGAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182087723 Original CRISPR CTGCTCTCAGAACCTGAAGT CGG Intergenic
No off target data available for this crispr