ID: 1182088020

View in Genome Browser
Species Human (GRCh38)
Location 22:27574786-27574808
Sequence CCGGCTCCAAACGCTTTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182088020_1182088027 19 Left 1182088020 22:27574786-27574808 CCGGGAAAAGCGTTTGGAGCCGG No data
Right 1182088027 22:27574828-27574850 ACTTTTCTGCTGTGTGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182088020 Original CRISPR CCGGCTCCAAACGCTTTTCC CGG (reversed) Intergenic
No off target data available for this crispr