ID: 1182091259

View in Genome Browser
Species Human (GRCh38)
Location 22:27596526-27596548
Sequence ACTCAAAGCCTCCACTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182091257_1182091259 13 Left 1182091257 22:27596490-27596512 CCTCAGAACTCGTAGGAATTTTC No data
Right 1182091259 22:27596526-27596548 ACTCAAAGCCTCCACTGTGGTGG No data
1182091256_1182091259 14 Left 1182091256 22:27596489-27596511 CCCTCAGAACTCGTAGGAATTTT No data
Right 1182091259 22:27596526-27596548 ACTCAAAGCCTCCACTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182091259 Original CRISPR ACTCAAAGCCTCCACTGTGG TGG Intergenic
No off target data available for this crispr