ID: 1182091285

View in Genome Browser
Species Human (GRCh38)
Location 22:27596650-27596672
Sequence TTTCCACGAAGCGGCCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182091275_1182091285 27 Left 1182091275 22:27596600-27596622 CCAGTTAAATGGAGCCAGCAGAG No data
Right 1182091285 22:27596650-27596672 TTTCCACGAAGCGGCCTCCCAGG No data
1182091279_1182091285 -9 Left 1182091279 22:27596636-27596658 CCCCATCCTCCTAATTTCCACGA No data
Right 1182091285 22:27596650-27596672 TTTCCACGAAGCGGCCTCCCAGG No data
1182091278_1182091285 -5 Left 1182091278 22:27596632-27596654 CCTTCCCCATCCTCCTAATTTCC No data
Right 1182091285 22:27596650-27596672 TTTCCACGAAGCGGCCTCCCAGG No data
1182091277_1182091285 13 Left 1182091277 22:27596614-27596636 CCAGCAGAGTCAGGAATTCCTTC No data
Right 1182091285 22:27596650-27596672 TTTCCACGAAGCGGCCTCCCAGG No data
1182091280_1182091285 -10 Left 1182091280 22:27596637-27596659 CCCATCCTCCTAATTTCCACGAA No data
Right 1182091285 22:27596650-27596672 TTTCCACGAAGCGGCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182091285 Original CRISPR TTTCCACGAAGCGGCCTCCC AGG Intergenic
No off target data available for this crispr