ID: 1182096585

View in Genome Browser
Species Human (GRCh38)
Location 22:27630233-27630255
Sequence CTGTGGATTAGGAGAGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182096585_1182096598 6 Left 1182096585 22:27630233-27630255 CCACCCCCTCTCCTAATCCACAG No data
Right 1182096598 22:27630262-27630284 GACTGAAGAGGCTATTCCCAGGG No data
1182096585_1182096596 -6 Left 1182096585 22:27630233-27630255 CCACCCCCTCTCCTAATCCACAG No data
Right 1182096596 22:27630250-27630272 CCACAGGGCAGGGACTGAAGAGG No data
1182096585_1182096602 22 Left 1182096585 22:27630233-27630255 CCACCCCCTCTCCTAATCCACAG No data
Right 1182096602 22:27630278-27630300 CCCAGGGCCCAGCCCAGATGGGG No data
1182096585_1182096600 21 Left 1182096585 22:27630233-27630255 CCACCCCCTCTCCTAATCCACAG No data
Right 1182096600 22:27630277-27630299 TCCCAGGGCCCAGCCCAGATGGG No data
1182096585_1182096597 5 Left 1182096585 22:27630233-27630255 CCACCCCCTCTCCTAATCCACAG No data
Right 1182096597 22:27630261-27630283 GGACTGAAGAGGCTATTCCCAGG No data
1182096585_1182096599 20 Left 1182096585 22:27630233-27630255 CCACCCCCTCTCCTAATCCACAG No data
Right 1182096599 22:27630276-27630298 TTCCCAGGGCCCAGCCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182096585 Original CRISPR CTGTGGATTAGGAGAGGGGG TGG (reversed) Intergenic
No off target data available for this crispr