ID: 1182102967

View in Genome Browser
Species Human (GRCh38)
Location 22:27670686-27670708
Sequence AGAAAGAAGCAGGCTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182102967_1182102983 20 Left 1182102967 22:27670686-27670708 CCTTCCCCAGCCTGCTTCTTTCT No data
Right 1182102983 22:27670729-27670751 CTTCCCCCTTCCCCCTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182102967 Original CRISPR AGAAAGAAGCAGGCTGGGGA AGG (reversed) Intergenic
No off target data available for this crispr