ID: 1182103847

View in Genome Browser
Species Human (GRCh38)
Location 22:27675124-27675146
Sequence GGGTGAACAACTGGAGAACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182103847_1182103851 -10 Left 1182103847 22:27675124-27675146 CCCCGTTCTCCAGTTGTTCACCC No data
Right 1182103851 22:27675137-27675159 TTGTTCACCCCAGCATTCTGAGG No data
1182103847_1182103856 0 Left 1182103847 22:27675124-27675146 CCCCGTTCTCCAGTTGTTCACCC No data
Right 1182103856 22:27675147-27675169 CAGCATTCTGAGGCCAGGACTGG No data
1182103847_1182103860 30 Left 1182103847 22:27675124-27675146 CCCCGTTCTCCAGTTGTTCACCC No data
Right 1182103860 22:27675177-27675199 TACATTTCAGAAAGGCATGTTGG No data
1182103847_1182103859 22 Left 1182103847 22:27675124-27675146 CCCCGTTCTCCAGTTGTTCACCC No data
Right 1182103859 22:27675169-27675191 GGCTGCTTTACATTTCAGAAAGG No data
1182103847_1182103852 -5 Left 1182103847 22:27675124-27675146 CCCCGTTCTCCAGTTGTTCACCC No data
Right 1182103852 22:27675142-27675164 CACCCCAGCATTCTGAGGCCAGG No data
1182103847_1182103857 1 Left 1182103847 22:27675124-27675146 CCCCGTTCTCCAGTTGTTCACCC No data
Right 1182103857 22:27675148-27675170 AGCATTCTGAGGCCAGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182103847 Original CRISPR GGGTGAACAACTGGAGAACG GGG (reversed) Intergenic
No off target data available for this crispr