ID: 1182103848

View in Genome Browser
Species Human (GRCh38)
Location 22:27675125-27675147
Sequence GGGGTGAACAACTGGAGAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182103848_1182103852 -6 Left 1182103848 22:27675125-27675147 CCCGTTCTCCAGTTGTTCACCCC No data
Right 1182103852 22:27675142-27675164 CACCCCAGCATTCTGAGGCCAGG No data
1182103848_1182103860 29 Left 1182103848 22:27675125-27675147 CCCGTTCTCCAGTTGTTCACCCC No data
Right 1182103860 22:27675177-27675199 TACATTTCAGAAAGGCATGTTGG No data
1182103848_1182103857 0 Left 1182103848 22:27675125-27675147 CCCGTTCTCCAGTTGTTCACCCC No data
Right 1182103857 22:27675148-27675170 AGCATTCTGAGGCCAGGACTGGG No data
1182103848_1182103856 -1 Left 1182103848 22:27675125-27675147 CCCGTTCTCCAGTTGTTCACCCC No data
Right 1182103856 22:27675147-27675169 CAGCATTCTGAGGCCAGGACTGG No data
1182103848_1182103861 30 Left 1182103848 22:27675125-27675147 CCCGTTCTCCAGTTGTTCACCCC No data
Right 1182103861 22:27675178-27675200 ACATTTCAGAAAGGCATGTTGGG No data
1182103848_1182103859 21 Left 1182103848 22:27675125-27675147 CCCGTTCTCCAGTTGTTCACCCC No data
Right 1182103859 22:27675169-27675191 GGCTGCTTTACATTTCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182103848 Original CRISPR GGGGTGAACAACTGGAGAAC GGG (reversed) Intergenic
No off target data available for this crispr