ID: 1182103850

View in Genome Browser
Species Human (GRCh38)
Location 22:27675133-27675155
Sequence AGAATGCTGGGGTGAACAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182103850_1182103857 -8 Left 1182103850 22:27675133-27675155 CCAGTTGTTCACCCCAGCATTCT No data
Right 1182103857 22:27675148-27675170 AGCATTCTGAGGCCAGGACTGGG No data
1182103850_1182103861 22 Left 1182103850 22:27675133-27675155 CCAGTTGTTCACCCCAGCATTCT No data
Right 1182103861 22:27675178-27675200 ACATTTCAGAAAGGCATGTTGGG No data
1182103850_1182103862 23 Left 1182103850 22:27675133-27675155 CCAGTTGTTCACCCCAGCATTCT No data
Right 1182103862 22:27675179-27675201 CATTTCAGAAAGGCATGTTGGGG No data
1182103850_1182103860 21 Left 1182103850 22:27675133-27675155 CCAGTTGTTCACCCCAGCATTCT No data
Right 1182103860 22:27675177-27675199 TACATTTCAGAAAGGCATGTTGG No data
1182103850_1182103863 27 Left 1182103850 22:27675133-27675155 CCAGTTGTTCACCCCAGCATTCT No data
Right 1182103863 22:27675183-27675205 TCAGAAAGGCATGTTGGGGCTGG No data
1182103850_1182103859 13 Left 1182103850 22:27675133-27675155 CCAGTTGTTCACCCCAGCATTCT No data
Right 1182103859 22:27675169-27675191 GGCTGCTTTACATTTCAGAAAGG No data
1182103850_1182103864 28 Left 1182103850 22:27675133-27675155 CCAGTTGTTCACCCCAGCATTCT No data
Right 1182103864 22:27675184-27675206 CAGAAAGGCATGTTGGGGCTGGG No data
1182103850_1182103856 -9 Left 1182103850 22:27675133-27675155 CCAGTTGTTCACCCCAGCATTCT No data
Right 1182103856 22:27675147-27675169 CAGCATTCTGAGGCCAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182103850 Original CRISPR AGAATGCTGGGGTGAACAAC TGG (reversed) Intergenic
No off target data available for this crispr