ID: 1182103857

View in Genome Browser
Species Human (GRCh38)
Location 22:27675148-27675170
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182103848_1182103857 0 Left 1182103848 22:27675125-27675147 CCCGTTCTCCAGTTGTTCACCCC No data
Right 1182103857 22:27675148-27675170 AGCATTCTGAGGCCAGGACTGGG No data
1182103845_1182103857 29 Left 1182103845 22:27675096-27675118 CCTCTGGATTCATCTGCAGTGGC No data
Right 1182103857 22:27675148-27675170 AGCATTCTGAGGCCAGGACTGGG No data
1182103849_1182103857 -1 Left 1182103849 22:27675126-27675148 CCGTTCTCCAGTTGTTCACCCCA No data
Right 1182103857 22:27675148-27675170 AGCATTCTGAGGCCAGGACTGGG No data
1182103847_1182103857 1 Left 1182103847 22:27675124-27675146 CCCCGTTCTCCAGTTGTTCACCC No data
Right 1182103857 22:27675148-27675170 AGCATTCTGAGGCCAGGACTGGG No data
1182103850_1182103857 -8 Left 1182103850 22:27675133-27675155 CCAGTTGTTCACCCCAGCATTCT No data
Right 1182103857 22:27675148-27675170 AGCATTCTGAGGCCAGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182103857 Original CRISPR AGCATTCTGAGGCCAGGACT GGG Intergenic
No off target data available for this crispr