ID: 1182103860

View in Genome Browser
Species Human (GRCh38)
Location 22:27675177-27675199
Sequence TACATTTCAGAAAGGCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182103855_1182103860 8 Left 1182103855 22:27675146-27675168 CCAGCATTCTGAGGCCAGGACTG No data
Right 1182103860 22:27675177-27675199 TACATTTCAGAAAGGCATGTTGG No data
1182103848_1182103860 29 Left 1182103848 22:27675125-27675147 CCCGTTCTCCAGTTGTTCACCCC No data
Right 1182103860 22:27675177-27675199 TACATTTCAGAAAGGCATGTTGG No data
1182103853_1182103860 10 Left 1182103853 22:27675144-27675166 CCCCAGCATTCTGAGGCCAGGAC No data
Right 1182103860 22:27675177-27675199 TACATTTCAGAAAGGCATGTTGG No data
1182103858_1182103860 -6 Left 1182103858 22:27675160-27675182 CCAGGACTGGGCTGCTTTACATT No data
Right 1182103860 22:27675177-27675199 TACATTTCAGAAAGGCATGTTGG No data
1182103847_1182103860 30 Left 1182103847 22:27675124-27675146 CCCCGTTCTCCAGTTGTTCACCC No data
Right 1182103860 22:27675177-27675199 TACATTTCAGAAAGGCATGTTGG No data
1182103849_1182103860 28 Left 1182103849 22:27675126-27675148 CCGTTCTCCAGTTGTTCACCCCA No data
Right 1182103860 22:27675177-27675199 TACATTTCAGAAAGGCATGTTGG No data
1182103850_1182103860 21 Left 1182103850 22:27675133-27675155 CCAGTTGTTCACCCCAGCATTCT No data
Right 1182103860 22:27675177-27675199 TACATTTCAGAAAGGCATGTTGG No data
1182103854_1182103860 9 Left 1182103854 22:27675145-27675167 CCCAGCATTCTGAGGCCAGGACT No data
Right 1182103860 22:27675177-27675199 TACATTTCAGAAAGGCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182103860 Original CRISPR TACATTTCAGAAAGGCATGT TGG Intergenic
No off target data available for this crispr