ID: 1182103862

View in Genome Browser
Species Human (GRCh38)
Location 22:27675179-27675201
Sequence CATTTCAGAAAGGCATGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182103858_1182103862 -4 Left 1182103858 22:27675160-27675182 CCAGGACTGGGCTGCTTTACATT No data
Right 1182103862 22:27675179-27675201 CATTTCAGAAAGGCATGTTGGGG No data
1182103850_1182103862 23 Left 1182103850 22:27675133-27675155 CCAGTTGTTCACCCCAGCATTCT No data
Right 1182103862 22:27675179-27675201 CATTTCAGAAAGGCATGTTGGGG No data
1182103853_1182103862 12 Left 1182103853 22:27675144-27675166 CCCCAGCATTCTGAGGCCAGGAC No data
Right 1182103862 22:27675179-27675201 CATTTCAGAAAGGCATGTTGGGG No data
1182103854_1182103862 11 Left 1182103854 22:27675145-27675167 CCCAGCATTCTGAGGCCAGGACT No data
Right 1182103862 22:27675179-27675201 CATTTCAGAAAGGCATGTTGGGG No data
1182103855_1182103862 10 Left 1182103855 22:27675146-27675168 CCAGCATTCTGAGGCCAGGACTG No data
Right 1182103862 22:27675179-27675201 CATTTCAGAAAGGCATGTTGGGG No data
1182103849_1182103862 30 Left 1182103849 22:27675126-27675148 CCGTTCTCCAGTTGTTCACCCCA No data
Right 1182103862 22:27675179-27675201 CATTTCAGAAAGGCATGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182103862 Original CRISPR CATTTCAGAAAGGCATGTTG GGG Intergenic
No off target data available for this crispr