ID: 1182106037

View in Genome Browser
Species Human (GRCh38)
Location 22:27690249-27690271
Sequence TCTCCCCCATTTCAAAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182106037_1182106044 20 Left 1182106037 22:27690249-27690271 CCATTTCTTTGAAATGGGGGAGA No data
Right 1182106044 22:27690292-27690314 AAGAGACTTCTGGGAATTGAGGG No data
1182106037_1182106045 21 Left 1182106037 22:27690249-27690271 CCATTTCTTTGAAATGGGGGAGA No data
Right 1182106045 22:27690293-27690315 AGAGACTTCTGGGAATTGAGGGG No data
1182106037_1182106040 -8 Left 1182106037 22:27690249-27690271 CCATTTCTTTGAAATGGGGGAGA No data
Right 1182106040 22:27690264-27690286 GGGGGAGATTTGGAGGTGCAAGG No data
1182106037_1182106041 10 Left 1182106037 22:27690249-27690271 CCATTTCTTTGAAATGGGGGAGA No data
Right 1182106041 22:27690282-27690304 CAAGGCATATAAGAGACTTCTGG No data
1182106037_1182106042 11 Left 1182106037 22:27690249-27690271 CCATTTCTTTGAAATGGGGGAGA No data
Right 1182106042 22:27690283-27690305 AAGGCATATAAGAGACTTCTGGG No data
1182106037_1182106043 19 Left 1182106037 22:27690249-27690271 CCATTTCTTTGAAATGGGGGAGA No data
Right 1182106043 22:27690291-27690313 TAAGAGACTTCTGGGAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182106037 Original CRISPR TCTCCCCCATTTCAAAGAAA TGG (reversed) Intergenic
No off target data available for this crispr