ID: 1182106679

View in Genome Browser
Species Human (GRCh38)
Location 22:27694788-27694810
Sequence CCCAGTAGGATCTTGTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182106679_1182106687 25 Left 1182106679 22:27694788-27694810 CCTGGCCACAAGATCCTACTGGG No data
Right 1182106687 22:27694836-27694858 GAGACAGGGACCCCAGGTTCTGG No data
1182106679_1182106685 11 Left 1182106679 22:27694788-27694810 CCTGGCCACAAGATCCTACTGGG No data
Right 1182106685 22:27694822-27694844 TGAATAAAGAGATGGAGACAGGG No data
1182106679_1182106683 3 Left 1182106679 22:27694788-27694810 CCTGGCCACAAGATCCTACTGGG No data
Right 1182106683 22:27694814-27694836 CAAATTTCTGAATAAAGAGATGG No data
1182106679_1182106686 19 Left 1182106679 22:27694788-27694810 CCTGGCCACAAGATCCTACTGGG No data
Right 1182106686 22:27694830-27694852 GAGATGGAGACAGGGACCCCAGG No data
1182106679_1182106684 10 Left 1182106679 22:27694788-27694810 CCTGGCCACAAGATCCTACTGGG No data
Right 1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182106679 Original CRISPR CCCAGTAGGATCTTGTGGCC AGG (reversed) Intergenic
No off target data available for this crispr