ID: 1182106681

View in Genome Browser
Species Human (GRCh38)
Location 22:27694793-27694815
Sequence TGCTTCCCAGTAGGATCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182106681_1182106686 14 Left 1182106681 22:27694793-27694815 CCACAAGATCCTACTGGGAAGCA No data
Right 1182106686 22:27694830-27694852 GAGATGGAGACAGGGACCCCAGG No data
1182106681_1182106688 26 Left 1182106681 22:27694793-27694815 CCACAAGATCCTACTGGGAAGCA No data
Right 1182106688 22:27694842-27694864 GGGACCCCAGGTTCTGGATTTGG No data
1182106681_1182106687 20 Left 1182106681 22:27694793-27694815 CCACAAGATCCTACTGGGAAGCA No data
Right 1182106687 22:27694836-27694858 GAGACAGGGACCCCAGGTTCTGG No data
1182106681_1182106685 6 Left 1182106681 22:27694793-27694815 CCACAAGATCCTACTGGGAAGCA No data
Right 1182106685 22:27694822-27694844 TGAATAAAGAGATGGAGACAGGG No data
1182106681_1182106683 -2 Left 1182106681 22:27694793-27694815 CCACAAGATCCTACTGGGAAGCA No data
Right 1182106683 22:27694814-27694836 CAAATTTCTGAATAAAGAGATGG No data
1182106681_1182106689 27 Left 1182106681 22:27694793-27694815 CCACAAGATCCTACTGGGAAGCA No data
Right 1182106689 22:27694843-27694865 GGACCCCAGGTTCTGGATTTGGG No data
1182106681_1182106684 5 Left 1182106681 22:27694793-27694815 CCACAAGATCCTACTGGGAAGCA No data
Right 1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG No data
1182106681_1182106690 28 Left 1182106681 22:27694793-27694815 CCACAAGATCCTACTGGGAAGCA No data
Right 1182106690 22:27694844-27694866 GACCCCAGGTTCTGGATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182106681 Original CRISPR TGCTTCCCAGTAGGATCTTG TGG (reversed) Intergenic
No off target data available for this crispr